1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faltersainse [42]
4 years ago
11

True or false: it is necessary to have a nervous system to sense and respond to the environment.

Biology
1 answer:
Mila [183]4 years ago
5 0
Hello!

This would be false as it is just nerves inside of the body impulsing between each other and that would not be necessary to adapt to a new environment. 

I hope this helped!

I am, yours most sincerely,
SuperHelperThingy
You might be interested in
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
mote1985 [20]

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

4 0
3 years ago
Which of these is the most common result of greenhouse gases altering the atmosphere of earth?
Trava [24]
The answer is global warming
6 0
3 years ago
In areolar connective tissue, ________ release histamine and cause local infalmmation.
Ksju [112]
Hello there,
The answer to your question is <span>mast

Hope this helps :))

~Top
</span>
6 0
3 years ago
The process through which an existing cell or organism is used to artificially produce a genetically identical copy is known as
Inessa05 [86]
The Answer is Cloning 

CLONING, The Process<span> of Generating a G</span>enetically Identical Copy<span> of a C</span>ell<span> or an O</span>rganism<span>. Cloning Happens Often or an Individual C</span>ell<span>. 
</span>
Ex.
S<span>egments of DNA are Replicated Exponentially </span>by<span> a P</span>rocess Known         as<span> Polymerase Chain Reaction, or PCR, a Technique That is Used Widely
</span><span> </span>in<span> Basic Biological Research.</span>
8 0
3 years ago
In order to be classified as a living thing an organism must have ?
grandymaker [24]
In order to be classified as a living thing an organism must share or have the characteristics that define for what a living thing is ought to be, can grow and develop, can respond to stimuli in the environment, and more.

The most fundamental are that organisms must be composed of cells, regardless whether that it is prokaryotic and or eukaryotic. All living things must be made of cells.
4 0
3 years ago
Read 2 more answers
Other questions:
  • An active continental margin may have a _____, while a passive margin generally does not
    5·1 answer
  • The _____ is the passageway from the vas deferens to the urethra.
    13·1 answer
  • I need help on biology plz anyone help
    8·1 answer
  • Which of the following statements best describes the major difference between metaphase I of meiosis and metaphase of mitosis?
    8·2 answers
  • Which of the following is true for a cell that has a nucleus
    8·1 answer
  • How does DNA make protein?
    8·1 answer
  • HELP ASAP!
    12·1 answer
  • Brainliest time
    10·2 answers
  • Does the stomach only does chemical digestion to break down food?
    10·1 answer
  • 5x5= Can you sub to my friend
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!