1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zheka24 [161]
4 years ago
9

If, after extensive research, the expected observations predicted by a theory fail to materialize, then the theory _____.

Biology
1 answer:
Vesnalui [34]4 years ago
3 0
The theory is likely wrong - the theory must then be rejected and a new theory should be proposed, one that will lead to a new hypothesis which then should be tested.
You might be interested in
What science and biology have in common<br> and why
Ksivusya [100]
Biology is the study of life, and uses the scientific method, the basis of science, to do so. Hypotheses are made, tested, and remade, until a theory is made, which then becomes Scientific law.
6 0
3 years ago
Experimental studies reveal that double-stranded DNA can exist in three different helical forms known as A, B, and Z DNA. Why do
FromTheMoon [43]

Answer:

The correct answer is - B-DNA is the most common form of the DNA present in the cell and a good approximation of the structure of DNA in the cell.

Explanation:

The B- DNA is a form of the DNA that is explained by Watson and crick by the double-helical structure model. B-DNA is the predominant form of the DNA out of the three forms of the DNA which are B-DNA, Z-DNA, and A-DNA.

B-DNA is is provide a good approximation of the structure of DNA in a cell and its most common form of DNA in a cell that makes it the most studied and focused form of DNA.

Thus, the correct answer is -  B-DNA is the most common form of the DNA present in the cell and a good approximation of the structure of DNA in the cell.

8 0
3 years ago
Read 2 more answers
What part of a blade of grass allows the grass to stand up
Oksanka [162]
Cellulose should be the answer
8 0
3 years ago
QUESTION 48 The teeth of grain-eating animals (such as horses) are usually broad and ridged. This makes the teeth suitable for g
kap26 [50]
This illustrates that the two animals (the horse and the lion) do not eat the same type of food. This could also show one way of classification between different animal species.
4 0
3 years ago
Which climate is warm,wet and located on the edges of the tropics?
ioda
Temperate Marine climates are warm, wet, and located on the edge of the tropics.

Hope this helps!!
6 0
4 years ago
Read 2 more answers
Other questions:
  • A average sneeze travels at about 100 miles an hour. Rebecca designs an experiment to increase the speed of sneezes. She subject
    15·2 answers
  • "during which phase of mitosis does the nuclear membrane dissolve completely and the chromatid pairs arrange themselves in a sin
    8·1 answer
  • Which statement most specifically describes mint? Mint is a dicot. Mint is a monocot. Mint is an angiosperm. Mint is a bulb plan
    15·2 answers
  • Which cell is found in the nervous system?
    6·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • The process of actual separation of cells at the end of mitosis is called _____.
    8·2 answers
  • How does human evolution or natural selection relate to the susceptibility of disease?
    11·1 answer
  • What is the ultimate source of energy for all ecosystems
    5·1 answer
  • *WORTH 25 POINTS*When a person sweats, water and essential solutes called electrolytes are lost from body fluid. Michelle drank
    12·1 answer
  • Which three organs help a plant carry out photosynthesis?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!