1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ehidna [41]
2 years ago
15

What is the endcroine system and how does it function

Biology
1 answer:
eduard2 years ago
5 0
<h3>♫ - - - - - - - - - - - - - - - ~Hello There!~ - - - - - - - - - - - - - - - ♫</h3>

➷ The endocrine system is an organ system that works to produce and secrete hormones. It works by producing and secreting hormones that serve many purposes in the human body. For example, the secretion of insulin helps to regulate the level of glucose in the blood.

<h3><u>✽</u></h3>

➶ Hope This Helps You!

➶ Good Luck (:

➶ Have A Great Day ^-^

↬ ʜᴀɴɴᴀʜ ♡

You might be interested in
Which of the following is a direct negative consequence of aquaculture?
seraphim [82]
D) relieving fishing pressure on over fished species
5 0
2 years ago
7 An atom consists of 12 protons, 12 electrons, and 12 neutrons. Which of the following can
andrew11 [14]
Yourblomb ss dndndnddb
3 0
3 years ago
Which statement about air is correct?
Montano1993 [528]

Answer:

Air is essential for all organisms

7 0
2 years ago
Read 2 more answers
Penicillin is made from:<br> fungi<br> bacteria<br> viruses<br> protozoa
Alexxx [7]
I know that Penicillin is made from mold, and I think mold is a fungus but I'm not 100% positive.
4 0
2 years ago
The best way to gain weight is to increase your _______ intake.
Makovka662 [10]
Yes, c because  you can cross out protein because thats healthy and you cant really increase  carbohydrate and c fat is the most unhealthy one so. and also fat is what makes you gain weight say theres to much "fat' in food.t
4 0
3 years ago
Read 2 more answers
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • In early spring, many wildflowers begin to grow,
    9·1 answer
  • The bones of the vertebral column form a cavity called the
    6·1 answer
  • What provides long term energy storage?
    5·2 answers
  • drag the labels onto the flowchart to show the relationship between the production of photons by the sun (engelmann light source
    7·1 answer
  • BRAINLIESTTT ASAP!!!!
    10·1 answer
  • This part of Earth's surface is where water is in solid form, including sea ice, lake ice, river ice, snow cover, glaciers, ice
    6·2 answers
  • Which feature differentiates Volvox from amoeba, euglena, and paramecia?
    14·1 answer
  • 6. This sea grass has had the sun shining on it for most of the day. What can the sea grass do because it is in sunlight?
    13·1 answer
  • Where is oxygen added to the blood?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!