1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marishachu [46]
3 years ago
5

How do researchers today routinely determine the depth of the water to the seafloor?

Biology
1 answer:
s2008m [1.1K]3 years ago
8 0
<span>High-resolution multibeam instruments.</span>
You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Creationists criticize the idea of natural selection as a circular argument, or tautology, claiming "the fittest are those that
Dafna11 [192]

Creationists criticize the idea of natural selection as a circular argument, or tautology, claiming "the fittest are those that survive, and survival is how fitness is defined. "

The definition of natural selection is not tautological because natural selection is measured by contribution to the next generation, not simply survival of an individual organism.

Tautologies or circular arguments are true at all times and therefore are not productive as theories since they cannot be disproved. A tautology is a statement which is true by necessity.

Natural selection is the prevalent theory which explains biological change by predicting the mechanism behind evolution.

Nevertheless, natural selection can be explained non-tautologically. It should be described as the theory which tries to speculate as well as retrodict evolutionary change by environmental forces affecting the organisms.

To learn more about natural selection here

brainly.com/question/9830102

#SPJ4

4 0
1 year ago
. The value of Maggie's car decreased by 10% since last year, when she bought it. If the car is now worth $15,000.00, how much w
Phoenix [80]
You multiply 15,000 by .1, which equals 1,500. Then you add that to 15,000. This equals 16,500. That is your answer.
7 0
3 years ago
Which of the following is the correct meaning of transpiration?
Step2247 [10]
I think it's the evaporation of water through the stomata :)
3 0
3 years ago
Read 2 more answers
Can a person live without salivary glands
Delvig [45]

Answer:

Sublingual glands are located under the tongue and the submandibular glands are beneath the jaw. Without these crucial salivary glands, the mouth would not be able to maintain tooth health nor moisture of any kind.

4 0
2 years ago
Other questions:
  • Large amounts of energy are required in order to join two atom's nuclei into a single nucleus and, in turn, create a new element
    8·1 answer
  • what characteristics must a substance have in order to be easily transported across the cell membrane?
    15·2 answers
  • What protein is involved in forming a ring around the neck of a clathrin-coated bud and pinching the vesicle off of the membrane
    7·1 answer
  • Over the past century, the percent of squirrels in the vicinity of Washington, DC, that are black instead of the more common gra
    12·1 answer
  • The distance of a cyclist that travels 5 hours at velocity of 12km/h? ​
    11·2 answers
  • Which geographic feature is responsible for helping bring humans and dogs to North America?
    14·1 answer
  • How do changes to genes affect the traits of an organism
    7·2 answers
  • 8 incorrect things for a lab
    9·1 answer
  • What term is defined as the ability of a test to detect small concentration of an antigen or antibody?
    15·1 answer
  • What charts, tables, or drawings would clearly show what you have learned in this lab?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!