<h2>respiracion aerobic</h2><h2>fotosintesis</h2>
organismo Eucaronte
<h2>pluricelular</h2><h2>reproduciion </h2><h2 /><h2 />
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Blood vessels visible in the posterior view of the heart include the Superior and inferior vena cava and the pulmonary veins. The superior vena cava and the inferior vena cava drain systemic venous blood into the posterior wall of the right atrium. The pulmonary veins transport blood from the lungs back to the heart and are best seen in posterior view of the heart. Other features visible in the posterior view include, right and left atrium, right and left ventricle, aorta, aortic arch, pulmonary veins and arteries, coronary sinus, coronary artery and posterior interventricular artery.
Answer:
Package the desired genetic material into a suitable plant virus and allow this modified virus to infect the plant. If the genetic material is DNA, it can recombine with the chromosomes to produce transformant cells.Explanation:
