1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sav [38]
3 years ago
13

Gregor Mendel demonstrated that traits are passed from parents to offspring independently of one another under all circumstances

that he tested. All other genetics researchers have observed this as well. Based on this information, the statement “traits are passed from parents to offspring independently of one another” is _____.
A.) a law
B.) a hypothesis
C.) a theory
D.) an observation
Biology
2 answers:
inn [45]3 years ago
8 0

Answer;

A.) a law

Explanation;

-A law is a statement based on repeated experimental observations that describes some phenomenon of nature. Proof that something happens and how it happens, but not why it happens.

- A Theory is a well-substantiated explanation acquired through the scientific method and repeatedly tested and confirmed through observation and experimentation.

-A Hypothesis is a proposed explanation for a phenomenon made as a starting point for further investigation.

GarryVolchara [31]3 years ago
4 0

Answer:

its a juss took the test

Explanation:

You might be interested in
The cells that develop to form the outer lining of an animal's body make up the _[blank]_.
Radda [10]

Answer:

The answer is ectoderm. The mesoderm is the middle layer of lining. The endoderm is the innermost layer. You can remember it by:

Endo/ sounds like inner

Meso/ M for middle

Ecto/ sounds like exo, bugs have exoskeletons that are on the outside.

Explanation:

4 0
3 years ago
Question 9 of 10
Andrew [12]
The answer is D. Groundwater depletion
4 0
3 years ago
When your brother throws a scissor at you and cuts your cheek and doesnt apoligize he's a jrek right guys
Tems11 [23]

Answer:

Yes why would he do that in the first place I hope you are ok

Explanation:

6 0
3 years ago
Read 2 more answers
Which of the following is important in accumulating and removing sand that result in shifting barrier islands?
elena55 [62]

Answer:

D. Longshore currents

Explanation:

Longshore currents are characterized as the sediment transport that occurs in the surf zone, due to the oblique incidence of the waves, along the beach. A current develops between the beach and the surf zone parallel to the coast, normally between 0.3 and 1 m / s. It is this process that is responsible for accumulating and removing sand that results in displacement of barrier islands.

5 0
3 years ago
What is the name for large molecules made up of smaller molecules?
Mashcka [7]

Answer:

Answer is molecules.

5 0
3 years ago
Read 2 more answers
Other questions:
  • The distortion of enzyme molecules which occurs at high temperatures is known as
    13·1 answer
  • 5. Convert 500°F to degrees Celsius.<br> a. 260°C<br> b. 296°C<br> c. 842°C<br> d. 958°C
    10·1 answer
  • . Which two biomes have the least precipitation?
    14·2 answers
  • Which of the following animals indicated in the Antarctica Food Web folder utilizes the Crabeater Seal as a source of food? a. H
    14·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Shoud a patient with a history of smoking be moved to the top of the transplant list?
    5·1 answer
  • Which characteristics of adaptive immunity ensures that vaccination effectively prevents disease?
    6·1 answer
  • If you were to place fertilized sea urchin eggs in a hypotonic tank, what would happen to them and why?​
    10·1 answer
  • Compare the growth of mutated cells with and without growth factors​
    13·1 answer
  • BRAINLIEST!!! CAN SOMEONE PLEASE ANSWER THIS!!!
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!