All categories

3 years ago

A pink flowered plant is crossed with a white flowered plant. what se the genotypes?

Biology

1 answer:

Angelina_Jolie [31]3 years ago

8 0

Answer:

The genotype for the pink flower is Rr and the genotype for the white flower

is rr. This would lead to a 50% chance of the offspring having a phenotype of pink.

Explanation:

You might be interested in

How does high altitude affect breathing? please help

GaryK [48]

<h2>Answer:</h2>

<em>Per my research, it was said that the higher the elevation, the more difficult breathing becomes. The air at higher altitudes is colder, less dense, and contains fewer oxygen molecules, which means that you would need to take more breaths in order to get the same amount of oxygen as you would at lower altitudes. </em>

<h2>Explanation:</h2>

<u><em>Hope this helped and please correct me if I am wrong. I did my research and I think this is right because of the elevation. Have a good one!</em></u>

7 0

3 years ago

Read 2 more answers

Which best describes the purpose of a fever

Maksim231197 [3]

High temperature from your body

3 0

3 years ago

Read 2 more answers

A 20-pound object is dropped from a 50-foot bridge onto the ground below it. A 50-pound object is dropped from a 100-foot cliff

ira [324]

The 50 pound object will reach the ground first.

Explanation:

Using the second equation of motion, we can derive the time taken for each of the object to reach the ground. As the object is thrown from the top of the bridge or cliff, acceleration due to gravity will be acting on them.

So, $s = ut+\frac{1}{2} at^{2}$

The value of s for the object thrown from 50 foot bridge is given as 50 ft. The initial velocity of the object will be zero. The acceleration can be written as the ratio of mass to gravitational force.

Then, $s = (0) t +\frac{1}{2}*\frac{m}{F}*t^{2}$

$50 = \frac{20}{2F} t^{2} \\\\t^{2} = \frac{100F}{20}$

$t = \sqrt{5F}$

Then, consider the time taken for the 50 pound object to reach the bottom of 100 ft cliff as t₁ and the displacement in this case is 100 ft.

Then, $100 = (0)t +\frac{1}{2}*\frac{50}{F}*t_{1}^{2} \\\\t_{1}^{2} =\frac{200F}{50}$

$t_{1} = 2 \sqrt{F}$

Since, the gravitational force acting on both the objects will be same, the ratio of time taken is

$\frac{t }{t_{1} }=\frac{\sqrt{5F} }{2\sqrt{F}} = \frac{\sqrt{5} }{2}$

So, the time taken for the 20 pound object to reach the ground of 50 ft bridge is √5 s =2.236 s and the time taken for the 50 pound object to reach the ground of 100 ft cliff is 2 s.

Thus, the 50 pound object will reach the ground first.

5 0

3 years ago

Please please please help me

Mumz [18]

Answer:

dont use the link

Explanation:

it nothing

5 0

3 years ago

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5′−GGCCCUUUUACCCGGUUUU−3′

Blizzard [7]

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

4 0

4 years ago