1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marysya [2.9K]
3 years ago
6

A county has recently evolved from underdeveloped to developed and the birth and death rate have stabilized. This is known as 

Biology
1 answer:
krok68 [10]3 years ago
4 0

Answer: demographic transition

Explanation:

You might be interested in
Why do you think that root hairs are produced only on the parts of the root system that have stopped growing?
Triss [41]

Answer:

question no 1 answer

A root hair,or absorbent hair, the rhizoid of a vascular plant, is a tubular outgrowth of a trichoblast, a hair-forming cell on the epidermis of a plant root. As they are lateral extensions of a single cell and only rarely branched, they are visible to the naked eye and light microscope. They are found only in the region of maturation of the root. Just prior to and during root hair cell development, there is elevated phosphorylase activity. Plants absorb water from the soil by osmosis. Root hair cells are adapted for this by having a large surface area to speed up osmosis. Another adaptation that they have is a large permanent vacuole.

question no 2 answer

Answer: Stems hold the plant upright and support it. They also transport water, minerals and sugars to the leaves and roots.

hope it helps

because i have taken it on by book

5 0
3 years ago
HELP ASAPPPP PLZZZ
SVEN [57.7K]
The quantity of matter in an object I belive it the right answer.

3 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
The map shows tectonic plates on Earth. The red arrows indicate which plates are converging, diverging, or transforming. Identif
Sliva [168]

Answer: Bottom Left Square.

5 0
3 years ago
Read 2 more answers
Help me now please for a cookie
Ivan
Without decomposers, dead leaves, dead insects, and dead animals would pile up everywhere. Imagine what the world would look like! More importantly, decomposers make vital nutrients available to an ecosystem's primary producers—usually plants and algae.
5 0
2 years ago
Other questions:
  • How the carbon cycle and nitrogen cycle contribute to the use of organic compounds
    8·1 answer
  • Which of the following human activities can increase the risks of flooding? a. cultivation b. planting trees c. soil management
    14·2 answers
  • All of the statements EXCEPT one are true about mutations. Which statement is false?
    15·2 answers
  • The density of ice is : greater than that of water equal to that of water less than that of water ??
    5·2 answers
  • There are over 100 alleles known for the gene associated with cystic fibrosis. With current technology, it is possible to determ
    12·1 answer
  • Solar energy received by the Earth's surface causes the Earth's surface to heat up during the day. Which of the following heat t
    15·2 answers
  • An atom that gain or loses an electron has a net eletric charge and is called a/n
    6·1 answer
  • when potatoes are in the ground, do they swell with water when it rains? If not, how do you explain that, and if so, what would
    8·1 answer
  • Please select the word from the list that best fits the definition
    13·1 answer
  • o ensure that all bacteria are removed from the puncture site for blood cultures, the site should be cleansed using friction for
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!