1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rufina [12.5K]
2 years ago
6

Biology help, please!

Biology
2 answers:
ivolga24 [154]2 years ago
8 0

The answer is C) Fats contain half the amount of energy than carbohydrates because they have less bonds.

kolezko [41]2 years ago
6 0
C is the awnser i hope this helped >_<
You might be interested in
Please help...
Grace [21]

The answer is; A, B, D


Celular respiration break down carbon-based sources of energy and harness the energy is chemical bonds through ATPs, the energy currency of cells. Some ATP is spent in initiating the biochemical reactions, however, there is a net positive gain in the produced ATPs at the end of the reactions.


5 0
3 years ago
Anywhere between 30–70% of individuals with diagnosed cases of Attention Deficit Hyperactivity Disorder (ADHD) also have some so
earnstyle [38]

Answer: C, Learning disability

Explanation:

5 0
3 years ago
What are tomatoes? fruit vegetables flowers roots?
Zigmanuir [339]

The confusion about 'fruit' and 'vegetable' arises because of the differences in usage between scientists and cooks. Scientifically speaking, a tomato is definitely a fruit. True fruits are developed from the ovary in the base of the flower, and contain the seeds of the plant (though cultivated forms may be seedless). Blueberries, raspberries, and oranges are true fruits, and so are many kinds of nut. Some plants have a soft part which supports the seeds and is also called a 'fruit', though it is not developed from the ovary: the strawberry is an example.

As far as cooking is concerned, some things which are strictly fruits, such as tomatoes orbean pods, may be called 'vegetables' because they are used in savoury rather than sweet cooking. The term 'vegetable' is more generally used of other edible parts of plants, such as cabbage leaves, celery stalks, and potato tubers, which are not strictly the fruit of the plant from which they come. Occasionally the term 'fruit' may be used to refer to a part of a plant which is not a fruit, but which is used in sweet cooking: rhubarb, for example.

So, the answer to the question is that a tomato is technically the fruit of the tomato plant, but it's used as a vegetable in cooking.


Hope this helps :)

7 0
3 years ago
Read 2 more answers
The earth is surrounded by a _______________________ of gases called the ________________. The atmosphere is very ______________
deff fn [24]

The earth is surrounded by <em>a layer of</em> gases called the <em>atmosphere</em>. The atmosphere is very <em>important </em>to life on <em>Earth</em> and does many <em>things</em> to help protect life and help<em> life </em>to survive.

The atmosphere absorbs the <em>heat</em> from the <em>Sun </em>and keeps the heat <em>inside</em> the atmosphere helping the <em>Earth </em>to stay warm, called the <em>Greenhouse </em>Effect.

7 0
2 years ago
What happens to the temperature of a sample of matter as it changes from a liquid to a gas?
irina1246 [14]
All matter can move from one state to another. It may require extreme temperatures or extreme pressures, but it can be done. Sometimes a substance doesn't want to change states. You have to use all of your tricks when that happens. To create a solid, you might have to decrease the temperature by a huge amount and then add pressure. For example, oxygen (O2) will solidify at -361.8 degrees Fahrenheit (-218.8 degrees Celsius) at standard pressure. However, it will freeze at warmer temperatures when the pressure is increased. i think
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which supports the idea of this ecosystem being open?
    5·1 answer
  • Which feature is found most often in prokaryotic cells?
    15·1 answer
  • Which kingdom is composed of multicellular autotrophs?<br> Animal<br> Fungi<br> Plant<br> Protist
    7·1 answer
  • What group of plants would flowering plants belong to?
    8·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • create a scientific argument of one to two paragraphs that support or oppose the current flu vaccine recommendations.
    14·2 answers
  • How many variables should you have in a control experiment?
    15·2 answers
  • O type blood contains what type of antigens?
    15·2 answers
  • If it's 0 degrees outside and it's suppost to be twice as cold tomorrow how cold would it be?​
    12·1 answer
  • Fred wants to summarize mitosis in the cell cycle. Which statement describes mitosis?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!