1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gre4nikov [31]
3 years ago
15

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 15 million years. Examine th

e DNA segments from two different species: Species A: GTTGAGCTAGTATGGACC Species B: GATAAGCTAGTAAGGTCA Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor. Be sure to answer this question in paragraph form using complete sentences.
Biology
1 answer:
Svetradugi [14.3K]3 years ago
3 0
<h3><u>Answer and explanation;</u></h3>
  • This can be done by<u> DNA sequencing which is the process of determining the accurate order of nucleotides within a DNA molecule</u>.
  • By doing a DNA sequencing for the two sequences of DNA from the two species it will help compare the number of random mutations which have occurred in a molecular clock in the two species - that is, seeing how different the sequences are.
  • This will make it possible to infer how long ago the species diverged.

Species A: GTTGAGCTAGTATGGACC

Species B: GATAAGCTAGTAAGGTCA

These species differ in 5 nucleotides.

This number should be multiplied by the rate of mutations; that is;

5 × 15 million years =75 million years.


You might be interested in
Stems play an important role in a plant's life except for
saul85 [17]

Answer:

D. predicting the age of the plant

Explanation:

stems don't exactly have those powers. but they do give support by holding the plant upright. they do give defensive properties. and they do increase the amount of sun exposure (like with sunflowers). but they don't predict anything.

5 0
3 years ago
The means by which a cell transports large molecules out of the cell is called
Paha777 [63]

Answer:

endocytosis

Explanation:

hope this helps if it does please mark brainliest

5 0
2 years ago
If a researcher electrically stimulates the _____ in an animal, the animal will immediately wake up and be alert.
jeka94
If a researcher electrically stimulates the reticular formation in an animal, the animal will immediately wake up and be alert. Its purpose is to have some control of sensory signals and thus has the ability to alert the body when it is tired or needs to be awake.
6 0
3 years ago
Climate is a global factor that produces a. Earth’s unique ocean and atmosphere. b. the shape and elevation of landmasses. c. a
sergiy2304 [10]

Answer:

ANSWER : a wide range of environmental conditions that shapes communities.

Explanation:

Climate can easily be described as the average weather which occurs in a place over a long period of time probably over many years. The ecosystems and habitats around the earth are shaped due to climate as particular climate can be best for the living condition of one organism but be devastating for the living of another organism. The effect of climate on living communities is such devastating that a change in climate can cause the extinction of a particular kind of species. Climate shall not be confused with weather which is day to day temperature change.

4 0
3 years ago
Read 2 more answers
Ann received 23 chromosomes from her mother and 23 chromosomes from her father. The combination of genes on these chromosomes co
Mkey [24]

As per the given scenario, the chances of an offspring as a male or female is 50% each.

<h3>What are chromosomes?</h3>

The thread like structure resides inside the nucleus is referred to as chromosomes.

As there are 23 pair of chromosomes present in the organisms, they transfer their equal numbers in the future generation with some variations.

As per the given image, it is clearly shown that there is 50% possibility of being male or female offspring.

Thus, the chances of an offspring of this pairing being born male or female are 50%.

For more details regarding chromosomes, visit:

brainly.com/question/1596925

#SPJ1

7 0
2 years ago
Other questions:
  • In which step of translation does the tRNA become charged? a.initiation b.activation c.elongation
    11·1 answer
  • What similarities and differences do prokaryotes have with modern day green plants
    9·2 answers
  • Write a claim, evidence, and a reason. About What is the relationship between photosynthesis and cellar respiration
    11·1 answer
  • Cells grown in laboratory culture dishes undergo only a fixed number of division before dying. The number of possible divisions
    9·1 answer
  • Are atoms often lost as heat to the environment
    7·1 answer
  • A(n) _____ is a cell that specializes in receiving and transmitting information
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • This photograph shows a protion of the Monahans Sandhills in northwest Texas. Monahans Sandhills are noted for their sand dunes
    8·1 answer
  • B. How does weathering affect Earth's surface?
    8·1 answer
  • Sexual reproduction has many benefits from a genetic standpoint. Can you think of any downside to sexual reproduction?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!