1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
r-ruslan [8.4K]
3 years ago
7

HELP!!

Biology
1 answer:
Elenna [48]3 years ago
5 0

Seasons

its the best option

You might be interested in
A scientist is planning to carry out an experiment on the effect of heat on the function of a certain enzyme which would not be
ANTONII [103]
If a scientist is planning to carry out such an experiment it wouldn't be appropriate to go and test this right ahead without any serious protection. It is always advised that scientists first collect data after they've created their initial hypotheses and read the required literature.
6 0
4 years ago
______ include cells that can function either independently or as a single unit
-Dominant- [34]
Prokaryotic cells are cells that can function independently. They consist of everything needed for that cell to nourish itself and to grow and reproduce. 
7 0
3 years ago
The reduced coenzymes generated by the citric acid cycle donate electrons in a series of reactions called the electron transport
Julli [10]

The reduced coenzymes generated by the citric acid cycle donate electrons in a series of reactions called the electron transport chain. The answers are as;

a) 1. NADH and 7. FADH2

b) 6. O2

c) 3. NAD+, 1. H2O, 4. ATP and 8. FAD

Oxygen is the ultimate electron acceptor, and it combines with hydrogen ions to produce H2O. This process occurs at the conclusion of the electron transport process.

ATP molecules, which are carriers of energy, would be the final outcome of the oxidative phosphorylation process.

(a) NADH and FADH2 donate electrons to the electron transport chain.

(b) O2 is the final electron acceptor.

(c)  NAD+,  H2O,  ATP, and  FAD are the final products of the electron transport chain and oxidative phosphorylation.

You can also learn about oxidative phosphorylation from the following question:

brainly.com/question/29104155

#SPJ4

4 0
1 year ago
What is the correct way to write an individual's blood pressure?
dmitriy555 [2]
Hello!

The blood pressure is supposed to be stable at all times to prevent strokes or other deadly effects. You measure the blood pressure with a sphygmomanometer around the arm and listen to the pulse. When completed, you would write the blood pressure like so: 120 over 80. If you write it any other way, it would be incorrect, so you measure the first sound first, then when the sound stopped and remember to write "over."

I hope this helped you!

I am, yours most sincerely,
SuperHelperThingy
3 0
3 years ago
In terms of particles, what is the difference between a liquid and a solid? *
cupoosta [38]

Answer:

1.

Explanation:

This is because the liquid has more energy than the solid, and plus If you heat it up then the particles will speed up.

3 0
2 years ago
Other questions:
  • Explain what the tyoes of mutations do ?
    7·1 answer
  • When you eat salmon for dinner, your digestive system will break down that food
    9·1 answer
  • This is probably a really dumb question but how does heating and cooling cause weathering?
    6·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Why does the amount of chlorophyll limit the rate of Photosynthesis?
    6·2 answers
  • All the cells in your body need ___________ to survive
    9·1 answer
  • la unica fuente de los aminoacidos esenciales son los alimentos y su anotemcion requiere de un gran gasto emergetico.si uma pers
    10·1 answer
  • Question 12 of 15<br> A force is a push or pull.
    14·2 answers
  • Climate change explains that the overall temperature of the planet is warming. How would this affect the trend in species as you
    15·1 answer
  • In stage 1 of photosynthesis, a proton gradient is generated and atp is synthesized. Where do protons become concentrated in the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!