1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tresset_1 [31]
4 years ago
15

A subducted plate melts forming ____? A) magma and volcanic mountains B) the lithosphere

Biology
1 answer:
Simora [160]4 years ago
7 0
A. Magma and volcanic mountains
You might be interested in
On the Challenger, scientists’ mission was to study organisms that live in the sea, the depths of the oceans, and the____. A. in
Andru [333]
The statement that could complete the statement that states about the Challenger's mission about the ocean and the best choice which is correct is in letter B. Water Chemistry. I hope you are satisfied with my answer and feel free to ask for more 
7 0
3 years ago
Read 2 more answers
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
3 years ago
3. Why is it that people living in poverty, who are often racial minorities, end up living in?
Virty [35]

Answer:

a lack of resources and stability can be a major factor for this situation, meaning they dont have much of a choice. they become a nuisance to richer clients and are therefore removed and dumped away.

5 0
1 year ago
If you were to rub your finger over the surface of your face, you would notice that the skin is oily. what makes up the oil
kumpel [21]
 Ruptured cells from sebaceous glands
7 0
3 years ago
The main function of the immune system is to provide what to the body
yanalaym [24]

Answer:

efends the body from microorganisms that could cause it harm or even death. one of the additional functions of the immune system. helps maintain homeostasis by removing old and or damaged cells from the body. complex and broad range of defensive mechanisms that the human body uses to combat infections and diseases.

Explanation:

4 0
3 years ago
Other questions:
  • When blue food coloring is dissolved in water, the result is a ________?
    12·1 answer
  • The human body uses the breakdown of macronutrients to obtain energy. the nutrients must be converted to (1)___________, which i
    15·1 answer
  • Isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine are known as the
    14·1 answer
  • Which situation would most likely result in evolution?
    8·2 answers
  • Obtain a copy of the Student Guide for this lab. Your teacher may provide a copy, or you can click the link to access it. Be sur
    11·2 answers
  • Can you help me thank you
    15·1 answer
  • Which substance increases its volume when it becomes a solid?
    15·2 answers
  • Question 7 of 10
    13·1 answer
  • Why is maintenance of a constant blood pH critical for body processes?
    5·2 answers
  • Linnaeus's two-word system for naming organisms is called
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!