1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivenika [448]
3 years ago
9

What types of materials are expelled from cells during exocytosis?

Biology
1 answer:
aivan3 [116]3 years ago
5 0

"Large molecules such as hormones" types of materials are expelled from cells during exocytosis.

<u>Answer:</u> Option A

<u>Explanation:</u>

The mechanism whereby a cell transfers secretory products to the plasma membrane via the cytoplasm is termed as "exocytosis" while material passage into the cell is known as "endocytosis". Exocytosis is need for removing waste material from cell.

In exocytosis, mechanism huge quantity of molecules which means bulk transport is performed.Responsible for secretion of digestive enzymes and hormones. In this process, membranes-bound secretory vesicle pass to the cell membranes while their material like water-soluble molecule get secreted in the extracellular atmosphere.

You might be interested in
What structure is most important in forming the tetrads?
Vladimir79 [104]

Answer:

The correct answer will be option- synaptonemal complex.

Explanation:

The tetrad arrangement of the genetic material in an organism is mediated by a highly conserved structure known as the synaptonemal complex.  The synaptonemal complex is formed during the prophase I of the meiosis I which attaches the chromatin of the homologous chromosomes.

The synaptonemal complex is a proteinaceous structure which is formed by the two lateral ladders like elements with a central portion composed of the central element. The chromatin gets attached to the lateral elements while the central a portion bridge space between the two ladders thus help in the formation of the tetrad.

Thus, option- synaptonemal complex is the correct answer.

4 0
3 years ago
PLEASE PLEASE PLEASE HELP ME IF YOU CAN!!!!!1!!!!!!!!!!!!
tankabanditka [31]

Explanation:

Compare and contrast a frameshift mutation and a single nucleotide substitution mutation in a DNA sequence encoding a protein. How many nucleotides would be inserted or deleted in each? How many amino acids in the protein sequence would be altered in each?

5 0
3 years ago
Help ASAP
Dmitry [639]

Answer:

D

Explanation:

The Moon stays in orbit around the Earth because the Earth's gravity keeps the Moon orbiting us. The gravity makes the Moon accelerate all the time, even it's speed remains constant.

7 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
What is a flower, how is it fertilized and why is it colorful/smell nice?
PilotLPTM [1.2K]

Answer:

flower is the part of a plant that is bright in colour and provides the pollen that is moved from plant to plant for pollination

7 0
3 years ago
Other questions:
  • 1.Find 4 human-related threats to seagrasses. Describe them fully.
    12·1 answer
  • Which organism is responsible for clean up in this ecosystem? prairie dog prairie grass vulture coyote
    7·2 answers
  • Which statement best describes the relationship of photosynthesis and energy?
    9·1 answer
  • What happens to the carrying capacity for insectivorous birds in winter in a northern New York forest?
    9·2 answers
  • The nursing student identifies which people as qualifed to administer anesthesia?
    13·1 answer
  • 5. Is the human circulatory system continuous or not?
    9·2 answers
  • A pathologic change in the cardiovascular system that involves degenerative changes in the arteries, promoting the accumulation
    11·1 answer
  • What part of a childs brain is resposible for licking and eating reflexes?
    10·1 answer
  • Which biome contains large populations of grazing herbivores, few species of birds, and deep, rich soil?
    6·1 answer
  • Which of the following statements about an energy pyramid is NOT correct?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!