1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
STALIN [3.7K]
3 years ago
10

Pre-Lab Questions What are two ways that some prokaryotes are able to survive in extreme environments? Describe three ways that

microorganisms in soil contribute to the ecosystem as a whole. Give two examples of genera that produce endospores, and explain why they are important in human health. What are coliforms? Why are they important in assuring water quality? Why is E. coli the indicator bacterium for fecal contamination?
Biology
1 answer:
il63 [147K]3 years ago
7 0

What are two ways that some prokaryotes are able to survive in extreme environments?

Answer:

1. Presence of thick cell wall in prokaryotes help them to survive in hypo-osmotic and hyper-osmotic conditions.

2. Production of endospores by bacteria. Bacteria use these structures to produce off sprigs because these structures are heat and drought resistant. They germinate when the conditions became favorable for growth.

Describe three ways that microorganisms in soil contribute to the ecosystem as a whole.

Answer:

1. As decomposer return the nitrogen contents back to ecosystem.

2. Bacteria detoxify may harmful substances present in water bodies therefore some species of bacteria are used for bio-remediation of ecosystem.

3. Bacterial byproducts help plant to grow faster because these byproducts act as stimuli for plant growth.

Give two examples of genera that produce endospores, and explain why they are important in human health.

Answer:

Endospore Producing Genus:

Bacteria belongs to genus Bacillus and Clostridium produce endospores.  

Importance for humans.:

1. Bacillus species are used to produce antibiotics, metabolites, enzymes which help in curing human diseases.

2. While species of Clostridium cause food poisoning in human.

What are coliforms? Why are they important in assuring water quality?

Answer:

Coliforms are gram negative bacteria have road like shape found in spoiled water.  

Importance:

These bacteria are important indicator of polluted water therefore in water quality testing their presence tells us about the water quality that how much is this water polluted.

Why is E. coli the indicator bacterium for fecal contamination?

Answer:

E. Coli found in the intestine of humans. As E. Coli itself does not cause mild infections therefore its presence indicates the presence if other deadly pathogens which may cause dangerous diseases to human.

You might be interested in
Darwin realized that ____ variation ________________ must be the starting point for change in nature. In any generation, the ani
Lilit [14]

Answer:Darwin realized that existing heritable variation in a generation must be the starting point for a change in nature. In any generation, the animals in the litter are never quiet the same. And in the wild,such a tiny heritable variation might make all the difference between life and death.

Explanation:

8 0
3 years ago
Read 2 more answers
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
Pani-rosa [81]
The probe would need to bind to the site
<span>TTTTAGCCATTTACGATTAATCG

The sites that are bold are were the probe need to bind in order to target the DNA. The sequence of the prob needs a site that is </span><span>complementary and antiparallel to it.</span>
4 0
4 years ago
Which element are in the substance that make about 60% od the male human body?
Korvikt [17]
Some 60 chemical elements are found in the body, but what all of them are doing there is still unknown. Roughly 96 percent of the mass of the human body is made up of just four elements: oxygen, carbon, hydrogen and nitrogen, with a lot of that in the form of water.
8 0
3 years ago
A snake is about to eat some small eggs it has found in a bird's nest. A hawk swoops down and eats the snake. What is the role o
vlada-n [284]
Hello there,

<span>A snake is about to eat some small eggs it has found in a bird's nest. A hawk swoops down and eats the snake. What is the role of the hawk?

I believe that your correct answer would be "</span><span>Tertiary consumer".

Hope this helps.

~Jurgen


</span>
8 0
4 years ago
Read 2 more answers
Why do wind-pollinated plants need to produce a large amount of pollen??
Leviafan [203]
Because they need to make a lot of light
7 0
3 years ago
Other questions:
  • A biology student wants to conduct a study of how the amount of food affects weight gain for mice. He sets up four cages with a
    14·1 answer
  • The common laboratory test used to analyze the volume of rbcs in a blood sample is the?
    15·1 answer
  • Which statement about cell division is accurate?
    9·1 answer
  • The number of living organisms in a particular area is _____. population density population community carrying capacit
    13·1 answer
  • Why do some foods have more caloric content per unit mass than other foods?
    14·1 answer
  • Wheat Germ Agglutinin is often usded as a marker of the cell surface. However, if the membrane of the cell is made permeable by
    13·1 answer
  • Some infants cannot synthesize several of the traditionally nonessential amino acids. These amino acids must be obtained from th
    8·1 answer
  • Which of the following are examples of sexual reproduction?
    8·2 answers
  • What are the two endocrine organs that work together to control blood calcium levels?
    11·1 answer
  • How can the species<br> composition of a community<br> or ecosystem change?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!