Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
In a food web there is a hierarchy, if any one of the parts of a food web is changed it can effect the parts above that may consume it, or the parts below that it may consume. Since the food web relies on balance and a hierarchy, if something changes it could disrupt the balance and flow of energy in the food web.
ATP can't store large amounts of energy for long periods of time.
The answer is letter d, it is because when a person becomes obese, he or she is likely to intake small amounts of food if he or she wants to maintain his or her weight and if the person does not want to gain weight anymore and than it is more different when gaining weight or when the person was in the point to become obese because he or she has ingested more food to gain weight.
