1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KatRina [158]
3 years ago
12

One of the most important protective factors for drug use is

Biology
1 answer:
jekas [21]3 years ago
6 0
<span> One of the most important protective factors for drug use is</span> believing that there are strong sanctions against substance abuse at school.

You might be interested in
In skeletal muscles, fast oxidative (intermediate) fibers are characterized as type ______, and they typically produce ATP throu
Salsk061 [2.6K]

Given what we know, we can say that In skeletal muscles, fast oxidative (intermediate) fibers are characterized as type ll-A, and they typically produce ATP through aerobic cellular respiration.

<h3>What are fast oxidative fibers?</h3>

These are a type of muscle fibers that can be trained. This means that they usually do not occur naturally but through continued muscle training by the individual. They are also referred to as enhanced fast-twitch muscle fibers. They are aerobic meaning that they require oxygen to undergo cellular respiration.

Therefore, we can confirm that fast oxidative (intermediate) fibers are characterized as type ll-A, and they typically produce ATP through aerobic cellular respiration.

To learn more about muscle fibers visit:

brainly.com/question/26168516?referrer=searchResults

7 0
2 years ago
Surface features that affect climate
Nitella [24]
Latitude and ocean currents are the ones i know.
4 0
2 years ago
The vaccine sends in a weakened or _______ Immune System mount the defense
Anna007 [38]

Answer:

fighting immune system

Explanation:

8 0
3 years ago
In 1883, a catastrophic event caused climate change, a massive tidal wave, and violently red sunsets. Which event below would be
bezimeni [28]
It’s A: a volcanic eruption
3 0
3 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Other questions:
  • Can someone please help me
    12·1 answer
  • The physical aspects of an ecosystem, or its include soil, water, and weather
    7·1 answer
  • Which structure would a unicellular organisms most likely have to move around?
    7·1 answer
  • To avoid such dangerous results, it is important to give a patient compatible blood. Which type of blood can a person with Type
    15·1 answer
  • A vaccine works to protect a mammal from a specific virus by having the mammal's body produce antibodies. The actual vaccine con
    7·2 answers
  • 1. Why do we experience different seasons on earth?
    13·2 answers
  • SOMEONE PLZ PLZ PLZ PLZ PLZ PLZ PLZ PLZ PLZ PLZ PLZ PLZ PLZ PLZ PLZ. Help me with number 5 question!!!!!
    5·1 answer
  • Bare rock
    12·1 answer
  • Describe how a person’s activity level can affect their health.
    7·1 answer
  • Does anyone know what they wanna do for the rest of their life job wise?????????????
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!