Given what we know, we can say that In skeletal muscles, fast oxidative (intermediate) fibers are characterized as type ll-A, and they typically produce ATP through aerobic cellular respiration.
<h3>What are fast oxidative fibers?</h3>
These are a type of muscle fibers that can be trained. This means that they usually do not occur naturally but through continued muscle training by the individual. They are also referred to as enhanced fast-twitch muscle fibers. They are aerobic meaning that they require oxygen to undergo cellular respiration.
Therefore, we can confirm that fast oxidative (intermediate) fibers are characterized as type ll-A, and they typically produce ATP through aerobic cellular respiration.
To learn more about muscle fibers visit:
brainly.com/question/26168516?referrer=searchResults
Latitude and ocean currents are the ones i know.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved