1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nika2105 [10]
2 years ago
7

Why are lemurs, lorises, and bushbabies considered descendants of the earliest primates?

Biology
1 answer:
Law Incorporation [45]2 years ago
4 0
All modern primates, including humans, are descendants of the earliest primates.
You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
A woman with normal color vision has a colorblind daughter. what are the genotypes and phenotypes of both parents
vovikov84 [41]
 The only possibility of the daughter being colour blind is where both parents have a recessive gene for colour blindness with the father being colour blind as well. so assuming the recessive allele is Xc, then the genotype of the mother is XCXc, where she has a normal colour vision and the father's genotype is XcY, where he is colour blind.
4 0
3 years ago
Beans may be tall or short depending on one locus, and they may have long or stubby pods, depending on another locus. A tall, st
lora16 [44]

Answer:

c. "short, long"

Explanation:

The question being described involves two different genes; one coding for beans length and the other for pod length. According to the question, beans may be tall (T) or short (t) while they can also have have long (L) or stubby pods (l).

From the phenotypic ratio result of the F1 generation, which were all tall and stubby, it is clear that tall bean (T) and stubby pods (d) are highest balloon. According to Gregor Mendel's ratio of dihybrid cross; 9.3.3:1, the least occuring phenotype, which is 1 of 16, can be "short, long".

4 0
2 years ago
Which describes the 23 pairs of human chromosomes?
Zigmanuir [339]

Answer:

option B

Explanation:

there are 22 pair of autosome and 2 pair of sex chromosome

3 0
2 years ago
Which is an inference?
Yanka [14]

Answer:

After watching a plant for a week, you determine it needs more sunlight.

Explanation:

Inference is a process by which, through certain data, a conclusion is reached. Other synonyms for inference are conclusion, implication, ilation and consequence.

Accordingly, an inference is made when after watching a plant for a week, you determine that it needs more sunlight. This was a conclusion based on data.

Not all inferences offer true conclusions, even with data analysis. It is possible to state that all dogs are furry animals with four legs, but it cannot be inferred that all furry animals that have four legs are dogs.

Inferences usually arise from an analysis of characteristics and probabilities. If someone makes reference to an animal with four legs, hairy and wagging its tail, it can be inferred that the most certain thing is that it is referring to a dog.

6 0
3 years ago
Other questions:
  • What is causing us to lose species on a daily basis?
    5·1 answer
  • How does random fertilization add to the genetic variation?
    9·2 answers
  • At which level of classification do tigers and humans split into 2 different groups?
    8·1 answer
  • A man and woman have a son who is color blind, a recessive sex-linked trait carried on the X chromosome, but neither parent is c
    15·1 answer
  • The allele for the ability to roll one's tongue is dominant over the allele for the lack of this ability. in a population of 500
    5·1 answer
  • As Kate is moving down the hill, what type of energy does she have? A. Sound energy B. Electrical energy C. Light energy D. Mech
    7·1 answer
  • When you stub your toe, you first feel a quick, sharp pain transmitted by _______, and then a moment later, a dull, throbbing pa
    11·1 answer
  • Rocks have been found in South America that are very similar in make-up and age to rocks in South
    7·1 answer
  • Bonjour, comment ca va ?
    13·2 answers
  • Signals from _______ and the body's _______ are received by the brain and the spinal cord
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!