1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rusak2 [61]
3 years ago
13

James observes an orbiting body that is approximately 5.2 AU away from the Sun. He knows that it is primarily composed of helium

and hydrogen. In which region of the solar system is the orbiting body located?
A. asteroid belt
B. inner planets
C. Outer planets
D. Kuiper Belt
Biology
2 answers:
Lilit [14]3 years ago
7 0
The heavenly body referred to in the question above is Jupiter. It is approximately 5.2 AU away from the sun. It is classified under the outer planets, so the answer is C. The Kuiper belt is around 50 AU from the sun. While the asteriod belt is 3.2 AU away. As for the inner planets, Mars, Earth, Venue, and Mercury are 1.5, 1, 0.7 and 0.39 AU away from the sun respectively. 
sdas [7]3 years ago
7 0

The correct answer is option C, that is, outer planets.  

In the given case, the heavenly body that is referred is Jupiter. It is about 5.2 astronomical units away from the Sun and is categorized under the outer planets. The Kuiper belt is approximately 50 astronomical units away from the Sun, on the other hand, the asteroid belt is about 3.2 astronomical units away from the Sun.  

In the case of inner planets, that is, the Earth, Mars, Venus, and Mercury, they are 1, 1.5, 0.7, and 0.39 astronomical units away from the Sun.  


You might be interested in
The desert sand dunes seen here are created through the processes of ___________ and ____________. A) wind and water. B) erosion
Agata [3.3K]

Answer:

C) Weathering and erosion

Explanation:

The completed sentence will be as follows -

The deserts and dunes seen here are created through the process of Weathering and Erosion.

Weathering is defined as the process of breakdown of rocks, soil and minerals into small particles under the influence of atmosphere, water and also biological organisms to some extent. The products of weathering are found at same place as the original rock with little or no movement.

In erosion, the materials such as rocks and soil or dissolved materials are transported from one place to the another place by the action of wind or water flow. So, here displacement of substances takes place.

8 0
4 years ago
What type of muscle tissue is attached to bone?
Afina-wow [57]

Answer:

striated

Explanation:

skeletal muscle: The voluntary muscle of vertebrates, which is striated and anchored by tendons to bone, is used to effect skeletal movement such as locomotion.

7 0
3 years ago
Answer both A and B. Thank you.
Margarita [4]

Explanation:

a.catalase

b.It plays important roles in host defense and oxidative biosynthetic reactions. In addition there is growing evidence that at low levels, H2O2 also functions as a signaling agent, particularly in higher organisms.

<h2>hope it helps.</h2><h2>stay safe healthy and happy..</h2>
6 0
3 years ago
Which statement describes P wave?
AleksAgata [21]

Answer:

They travel through liquids.

Explanation:

P waves are a type of seismic waves and they travel through solid, liquid and gas. They are called P waves because they are faster than the S waves and other types of seismic waves.

The p waves being the fastest is why it was named primary (p waves) while the S waves are slower and are referred to as secondary (s waves). These waves don’t start as surface waves but later results in it.

7 0
3 years ago
Read 2 more answers
What specific key factor starts the breathing process in a newborn infant?
kvv77 [185]
Chemical factors: This is due to internal stimuli. Changes in the blood such as decrease in O2, increase in CO2 and decrease in PH cause impulse in the carotid artery which stimulates the respiratory centers in the medulla and cause breathing.

Mechanical factors: also called external stimuli. Compression of the fetal chest during delivery forces small amount of lung fluid out of the lungs. This increase in pressure in the chest draws air into the lungs.
4 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • A researcher finds that white bread contains more preservatives and has a higher moisture content than wheat bread. She designs
    9·2 answers
  • Describe the forms that water takes through out the water cycle
    15·1 answer
  • How does the structure of DNA differ from the structure of RNA?
    10·2 answers
  • How does the endocrine system communicate with the other body systems
    8·1 answer
  • Why is it easy for a virus to mutate?
    7·1 answer
  • describe the basic process of evolution by natural selection. Describe the underlying genetic basis and role of the environment
    14·1 answer
  • When we doing strawberry extraction,why do we have to remove the air as much as possible before we seal the bag?
    14·1 answer
  • Identify structures C and D
    11·1 answer
  • In your opinion is it important to worry about the waste we produce and<br> why? 1 paragraph*
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!