1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xz_007 [3.2K]
3 years ago
14

Will mark brainliest if correct!

Biology
1 answer:
Aliun [14]3 years ago
8 0

Answer: A. Idk for sure it might be C. or E.

Explanation:

You might be interested in
Within the cell's endoplasmic reticulum, the proteins are packed into membranebound sacks called ____?
sweet [91]
Within the cell's endoplasmic reticulum, the proteins are packed into membranebound sacks called lyosomes?
5 0
3 years ago
Read 2 more answers
Quiz: Human Impact on Ecosystems 8:Human Impact and Technology
Genrish500 [490]

Answer:

it's usually because they have no predators or very little

Explanation:

Having no predators means a lot of growth for the organism. this can easily lead to extinction of other organism

7 0
3 years ago
What two body systems work together in combination in order for ambulation to accure
REY [17]
Skeletal and Muscular Systems
7 0
3 years ago
Which body system maintains fluid balance, absorbs lipids, and protects the body against pathogens?.
Vaselesa [24]

Answer:

Lymphatic system

Explanation:

The lymphatic system helps maintain fluid balance in the body by collecting excess fluid and particulate matter from tissues and depositing them in the bloodstream.

5 0
2 years ago
What is natural selection?
klasskru [66]

Natural Selection is the process where organisms with favorable traits are more likely to reproduce and spread their traits into the next Generation. Over time this process allows organisms to adapt and evolve to their environment.

8 0
3 years ago
Read 2 more answers
Other questions:
  • One way to help keep animals and habitats healthy is to make sure the number of animals never exceeds the habitat's carrying cap
    13·1 answer
  • Which is not a function of antibodies? neutralize antigen. agglutinate or precipitate antigen. activate complement enhance phago
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Is it true that the somatosensory cortex controls motor responses and higher mental functions
    9·1 answer
  • Replication of DNA takes place in the ______ during the ______ phase of Interphase.
    6·1 answer
  • How are valves in the circulatory system similar to sphincters in the digestive system?
    5·1 answer
  • Based on the scientists results, which of the following is true?
    8·1 answer
  • In yeast cells the process that occurs when there is not enough oxygen for aerobic respiration is called ?
    7·1 answer
  • What does render mean in scientific terms and how would you use it in a sentence
    11·1 answer
  • What will happen to blood flow if the resistance to flow increases, while the pressure gradient across a blood vessel remains co
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!