1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
coldgirl [10]
3 years ago
12

What is the scientific name of the Siberian wood frog?

Biology
1 answer:
Rzqust [24]3 years ago
5 0

easy it is Rana amurensis

You might be interested in
Which of these terms refers to tissue that forms from abnormal cell division?
Arada [10]
The answer is:  [D]:  "tumor" .
________________________________________
7 0
3 years ago
Erve cells nerve cells are long, thin cylinders along which electrical disturbances (nerve impulses) travel. the cell membrane o
Delicious77 [7]

The nervous system sends messages from nerve endings to the brain and from the brain to cells, tissues, and organs. Cells of the nervous system sometimes secrete chemical messengers instead of neurotransmitters. These specialized nervous system cells are called neurosecretory cells, and they produce neurosecretions. Every nerve cells are long, thin cylinders along which electrical disturbances (nerve impulses) travel. the cell membrane of a typical nerve cell consists of an inner and an outer wall separated by a distance of 0.10 μm and the electric field within the cell membrane is 7.0×105n/c.

8 0
3 years ago
Physical removal of an invasive species is an example of _______.
lana66690 [7]

Answer:

A. Mechanical

Explanation:

3 0
3 years ago
Read 2 more answers
 In which of the following situations is salinity highest? 
alexdok [17]
C) evaporation exceeds precipitation 

7 0
3 years ago
Which of these is a likely result of a beneficial or helpful mutation?
Neporo4naja [7]

Answer:

The answer would be C. An organism is able to better withstand a toxin!

Explanation:

This is most likely because if it is a beneficial mutation, it has an effect that allows the organism to better survive and thrive, and being able to withstand a toxin can definitely support survival and reproduction.

I really hope this helped you! Have a nice day! :)

5 0
3 years ago
Other questions:
  • HELP? Use the description of each cell to determine which phase of the cell cycle the cell is in. Explain your reasoning.
    8·1 answer
  • Describe at least two ways bone functions in protection of the human body.
    12·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Why is it important to study sunspots? How can they affect Earth?
    8·2 answers
  • Eubacteria lack a nuclear membrane so nuclear material is found throughout the cell A. True B. False
    12·1 answer
  • Need help with this please help
    9·2 answers
  • Which cell stucture is responsible for the passage of material into and out the cell
    10·1 answer
  • RNA and DNA are both examples of _____ made from nucleic acids.
    9·2 answers
  • Which animals in the Epipelagic Zone are both producers,consumers,and decomposers
    6·1 answer
  • Which forms as a result of compressional stress?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!