Proteins have many functions and express your traits
Answer:
The Answer is C
Explanation:
When scientists breed cows to produce more milk, this has not occured naturally and thus is not natural selection.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Tundra and deserts are two biomes of the world which represent the extreme form of climates. Tudra is the coldest region of the earth while desert represent the hottest zones of the earth. But whats the most common thing in these extreme zones is that they receive very less precipitation throughout the year (less than 25 cm).
Therefore, flora of the desert and Tundra have some special adaptations to survive without sufficient amount of water.
Let's see what are those:
- The height of plants growing in Tundra is very less like lesser than 1 foot. The short structure of the plants helps them to get more heat from the dark soil and helps to survive freezing. The short height lets them stay protected from harsh effects of cold or snow.
- The plants in tundra grow in groups or clumps that helps them in surviving the attacks of ice particles or snow balls. For example: lousewort and Arctic crocus.
- Some flora of tundra has ability to grow even in the complete lack of water for several years.This is because they have waxy layers that cover the leaves and store maximum water for the periods of no availability.
- Some plants have hair on the surface of stems that trap maximum heat and protect the plant from heat and extreme forms of wind. For example: Arctic crocus.
- Desert plants not only have physiological but also morphological adaptations to survive heat stress and shortage of water. Their stems, roots and leaves are fleshy and help them to store water for a large period of time. For example: Cactus
- Many desert plants like <em>xerophytic bromeliads</em> and <em>epiphytic orchids </em>contain a system alternate of photosynthesis called CAM (Crassulacean Acid Metabolism). This process helps the plant to open the stomata at night for exchange of gases and accumulate CO2. In day, stomata are closed and the CO2 is used for photosynthesis. This is an adaptation, because during night when temperature is low, CAM plants lose less water as compared to what normal plants lose during day.
- Some plants have extremely large roots that absorb maximum water from soil and compensate the plant's loss of water due to heat. For example: Phreatophytes.
- Some Perennial plants have adapted the mechanism to stay in condition of rest or dormant during extreme heat. They get back to normal life when weather become a bit better.
Hope it helps! :)
