Answer: Mechanical Isolation
Explanation:
Mechanical isolation is a type of barrier that prevents the species that are closely related from mating with each other.
It is used in case of plants and animals(here beetles) in which the without compatible sex organs individual of different species will not be able to mate and produce offspring.
Thus, the correct answer is option C
Basically the seed contains 2 parts, the testa, which is the seed coat that protects the seed and cotelydon, which is the inside of the seed, containing the radical and plumle.
for seed to germinate, we need 3 basic conditions,
warmth, it is the suitable temperature for seed germination, it can influence the activity of enzymes. providing a optimum temperature
water, to soften down the testa so that the shoot can break out from the testa
and oxygen, for aerobic respiration
.
If these conditions are absent, the seed may be in the state of dormancy. where is won't germinate until it meets the suitable conduction.
after that, the enzyme will digest the nutrient inside the seed and provide amino acid, which is necessary to seed germination. and meanwhile the aerobic respiration provides energy, so that the plumlecan shoot out, and be the shoot of the plant.
and then until it grows leaves, it'll start to complete photosynthesis, instead of using the nutrients inside the cotelydon.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
