Answer:
Neither A nor B is correct
Explanation:
Hydrologic cycle is the sequence of different conditions through which the water passes from oceans to clouds, precipitates as rains, comes to the rivers and finally reaches the ocean.
This first statement in the question said that water will end up in the river which is not true because water from the river ultimately ends in the oceans because all the rivers terminate in the oceans finally.
The second statement is also wrong because when water from one ocean vaporizes and becomes cloud, it can travel large distances as clouds in the effect of wind and thus may get precipitated in the form of rain in some other part of the world. So, it is not necessary that the water will end up in the same ocean.
Specialized tissue on the wall between the atria. Electrical impulses pass from the pacemaker (SA node) through the _______ and the atrioventricular bundle (bundle of His) toward the ventricles.atrium (pl. atria)One of two upper chambers of the heart.capillary<span>Smallest blood vessel. Materials pass to and from the bloodstream through the thin walls. They have walls that are only one endothelial cell in thickness. This delicate, microscopic vessel carries nutrient-rich, oxygenated blood from the arteries and arterioles to the body cells. There, the nutrients are burned in the presence of oxygen (catabolism) to release energy.
At the same time, waste products such as carbon dioxide and water pass out of the cells and into these blood vessels. Waste-filled blood then flows back to the heart in small venues, which combine to form larger vessels called veins.</span>carbon dioxideGas (waste) released by body cells, transported via veins to the heart, and then to the lungs for exhalation.coronary arteriesBlood vessels that branch from the aorta and carry oxygen-rich blood to the heart muscle.deoxygenated bloodBlood that is oxygen-poor.diastole<span>Relaxation phase of the heartbeat.</span>
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
