Answer:
true
Explanation:
because it can catch heat waves and other things
A Column Chart is the best place to start. After you put the data all in on place then using a bar graph or statistic line graph is the best place to begin building your data point
Answer:
Maltose is a disaccharide sugar made up of two units of glucose.
In cyclic structure, the glucose exists in two anomeric forms; alpha and beta.
These glucose units can either joined by α (1→4) glycosidic bond or by β (1→4) glycosidic bond.
Thus, the maltose exists in two anomeric form alpha and beta.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
A smaller person would have a lower metabolism rate than a taller person.