1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Advocard [28]
3 years ago
15

Which features of Mt. Lico isolate the forest on the mountain from the surrounding area?

Biology
1 answer:
katen-ka-za [31]3 years ago
4 0

Answer: See explanation below for answer.

Explanation: Mount Lico is an inselberg, meaning that it is an isolated mountain that rises abruptly from the surrounding plain. At the top of the mountain is a forest that lacks exploration and exploitation by humans.

The mountain is located the Zambezia province in northern Mozambique. It is 1,100 meters or 3,600 feet above sea level, and this is the major reason why it lacks exploitation by humans.

The features of Mount Lico that isolate the forest on top the mountain from the surrounding area are its height and sheer rock walls (which can be up to 700 meters).

You might be interested in
A) How can we prevent draught? mark
uysha [10]

Answer:

a) irrigation system b) cloud seeding

Explanation:

  • like a hose or line that distributes water where needed and cloud seeding is flying aircraft to a cloud that has little rain droplets already present and it shoots salt flares into the cloud to enhance rainfall
4 0
3 years ago
Will do what ever it takes
OLga [1]
Um what’s the question?
3 0
3 years ago
Read 2 more answers
Describe how having dark skin may have provided an advantage in survival and reproduction to people thousands of years ago in so
Lemur [1.5K]

Answer:

Recent studies have shown that dark skin colour was developed in the past for protection against cancer. Scientists claim that in the past natural selection favoured humans having dark colour as compared to humans having a fair colour. This is because humans having a darker colour produced more melanin which protected them from ultraviolet radiation. As a result, this skin colour protected more against skin cancer. Hence, Having a darker skin colour protected in survival and reproduction to people thousands of years ago.

6 0
3 years ago
Which of the following best explains how the expression of a eukaryotic gene encoding a protein wil differ if the gene is expres
Ivan

Answer: c. The protein will be made but will not function, because prokaryotes cannot remove introns.

Explanation:

Eukaryotic cells are cells that have membrane-surrounded organelles, such as a nucleus which is an organelle that stores the DNA, the genetic material. On the other hand, prokaryotic cells do not have a nucleus, and the genetic material is a single molecule, usually circular and closed and double-stranded, which is located in a sector of the cell known as the nucleoid (meaning "similar to the nucleus"), which does not imply the presence of a nuclear membrane.

<u>A gene is a unit of information at a DNA locus that codes for a protein. To synthesize that protein, DNA must be transcribed into messenger RNA (mRNA), and that mRNA is read by ribosomes in a process called translation or protein synthesis</u>. The difference between protein synthesis in prokaryotic and eukaryotic cells is that in prokaryotes, transcription and translation take place directly in the cytoplasm since there is no nucleus. In eukaryotes, transcription takes place inside the nucleus, to generate mRNA. This mRNA molecule is then directed to the cytoplasm where translation happens.

a. In prokaryotic cells, ribosomes are produced in the cytoplasm, whereas in eukaryotic cells they are generated in the nucleolus within the cell nucleus. So they both have ribosomes and they are used to make proteins, then this option is true.

b. RNA polymerase initiates transcription of all different types of RNA (mRNa, ribosomal RNA and transfer RNA). However, there are three RNA polymerase variations, each one translate a different type of gene. But, prokaryotic RNA polymerase can translate eukaryotic genes. Then this option is not true.

c. Prokaryotic cells don't  have introns because those cells do not perform a post-transcriptional RNA modifications, only done by eukaryotic cells. One of the modifications is the excision of introns in RNA. An intron is a region of DNA that is part of the primary RNA transcript, but unlike exons, they are removed from the mature transcript prior to translation. <u>So, this remotion does not happen in prokaryotes because they just don't have introns</u>. Also, in prokaryotic cells. the translation and transcription machinery is coupled. So, the transcription and translation occurs simultaneously, there will be no remotion of introns then the protein will be synthesized differently, since the reading frame is changed. Remember that each codon (set of three nucleotides) codes for an amino acid. So if the gene sequence is different because certain sections of the gene have not been removed, the protein will be different, and probably it will not function. This option explains how the expression of an eukaryotic gene encoding a protein will differ if the gene is expressed in prokaryotic cells.

d. The genetic code is the set of rules that defines how a sequence of nucleotides in RNA is translated into a sequence of amino acids in a protein. This code is common to all living organisms, although there are small variations, and it has a unique origin and is universal.  So, the code defines the relationship between each sequence of three nucleotides, called a codon, and each amino acid.  The sequence of genetic material is composed of four distinct nitrogenous bases, which are represented by letters in the genetic code:

  • Adenine (A)
  • Thymine (T)
  • Guanine (G)
  • Cytosine (C)
  • Uracil (U), only in RNA (instead of T)

So, the genetic code is the same for eukaryotes and prokaryotes. So this option is not true.

7 0
3 years ago
What are the small components (monomers) that make up the large DNA polymer?<br> (15 points)
Natasha2012 [34]
They are called <span>nucleotides. </span>
4 0
3 years ago
Other questions:
  • Which invertebrate is NOT bilaterally symmetrical ?
    9·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How are pollutants released by fossil fuels and how do they damage your health and the environment?
    12·1 answer
  • In simple dominance, what is the result when a dominant allele pairs up with a recessive allele?
    9·2 answers
  • How are bacteria, a rose, and an elephant alike?
    14·2 answers
  • HELP ASAP I WILL GIVE BRAINLIST
    7·1 answer
  • The first organism in most natural food chains is
    11·2 answers
  • Hi guys <br><br><br><br>I'm new here​
    12·1 answer
  • Can someone give me the answers and teach me how to do this?
    8·1 answer
  • How do coral reefs help with climate stability?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!