1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zarrin [17]
3 years ago
13

In the last century, the extent of global rain forests has been reduced by _____. one-half

Biology
2 answers:
stepladder [879]3 years ago
5 0
A is your answer, I just got it right o my test figured id help you out
Elodia [21]3 years ago
4 0

The correct answer is - one-half.

In the past century, the deforestation of the rainforests in the world had been devastating, and it is estimated that approximately one half of the tropical rainforests have been destroyed.

The reason for the large scale destruction of the rainforests is mainly because of clearing space for agriculture and for spaces where the cattle can graze. Unfortunately, the people that live the regions where the tropical forests are, are not well educated as to how to manage the land, and a big problem is that the soil of the rainforests is only good for 2-3 seasons, because it spends and erodes very quickly. Because of that, people just continue to clear more and more of it, thus leaving destroyed forest and destroyed soil behind them, without taking in consideration the long term effects.

You might be interested in
Which of the following is NOT an echinoderm?
kupik [55]
I beleive jelly fish
8 0
3 years ago
A scientist looks under a microscope and sees two cells in the process of dividing. Which principle of cell theory would this ev
sveticcg [70]

Answer:

All cells arise from pre existing cells.

Explanation:

one of the principles on the cell theory states that all cells came from pre existing cells . The two cells are parent cells who are big enough to undergo mitosis. The 4 cells made out of this event are daughter cells .

4 0
2 years ago
What type of glands are the ceruminous glands?
Strike441 [17]
I think it’s gonna be D.
4 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Explain why an individual that is heterozygous for this inversion would be partially sterile
Ipatiy [6.2K]
<span>Heterozygotes for inversion have a serious problem chromosome pairing at meiosis and recombination within the characteristic loop leads to chromosome duplication, deficiencies and in some cases two centro meters after recombination in meiosis.The abnormalities are usually not recovered in next generation because gametes or zygotes are receiving them are in-viable.</span>
4 0
3 years ago
Other questions:
  • Spermatogenesis produces __________________ from one original cell.
    6·2 answers
  • worldwide, fisheries are on the decline due to problems in fishing practices. discuss at least three of these destructive practi
    8·1 answer
  • a scientist investigates two types of cells located in different parts in the human body. cell A contains many more mitichondria
    8·2 answers
  • Air can be disinfected using __________
    15·1 answer
  • How canna person donate blood and never run out of it?
    11·1 answer
  • Which of the following diseases is caused by exposure to particles inhaled primarily in theworkplace (silica, coal dust, etc.)?S
    11·1 answer
  • The final fate of electrons in the electron transport chain is combining with _____ to form _____. hydrogen, ATP carbon, carbon
    8·1 answer
  • One reason that regulation of gene expression is important is that it saves energy and materials from being used when they are n
    10·1 answer
  • 1. Which sequence places the steps in the correct order? 1. Transfer RNA picks up individual amino acids and carries them to the
    7·1 answer
  • Which one is not considered a limiting factor when referring to carrying capacity?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!