1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serjik [45]
3 years ago
6

PLEASE HELP

Biology
2 answers:
faust18 [17]3 years ago
8 0
B) Around March 21 and September 22

<span>These dates are called Equinox dates </span>
<span>(March 21 = Spring equinox) </span>
(September 22 = Autumnal / fall equinox).

<span>The word equinox means equal nights.
brainliest?

</span>
Tpy6a [65]3 years ago
6 0
The answer is b hope i helped
You might be interested in
Why do living things need food, water, and the ability to get rid of waste
Doss [256]
To absorb nutrients and help us grow and to get rid of harmful bacteria
7 0
3 years ago
Read 2 more answers
Contrast primary succession and secondary succession. Give an example of each.
just olya [345]

Answer:

Primary succession occurs following an opening of a pristine habitat, for example, a lava flow, an area left from retreated glacier, or abandoned strip mine. In contrast, secondary succession is a response to a disturbance, for example, forest fire, tsunami, flood, or an abandoned field.

Explanation:

8 0
3 years ago
What store color pigments
Rina8888 [55]
Chromoplast(Plastid) is the answer you are very welcome
6 0
3 years ago
What are the steps of DNA Replication in order?
slega [8]

Explanation:

1) The enzyme helicase catalyses the unwinding of the two DNA strands by disrupting the hydrogen bonds between complementary base pairs.

2) Single-stranded binding proteins attach to the DNA strands to stabilise them and prevent them from joining back together.

3) The enzyme primase catalyses the addition of a short primer consisting of RNA nulceotides to the DNA strand. This serves as an 'anchor' DNA polymerase to initiate replication.

4) The enzyme DNA polymerase synthesizes a new DNA strand by incorporating DNA nucleotides complementary to the existing strand. DNA polymerase activity only occurs in the 5' ---> 3' direction.

5) The enzyme ligase catalyses the formation of hydrogen bonds between the two new pairs of DNA strands, and seals any breakages in the sugar-phosphate backbone.

6 0
3 years ago
What are large molecules assembled from smaller, individual molecules? A. nucleotides. B. polymers. C. ribosomes. D. hydrogen bo
Svetlanka [38]
Polymers are defined as large molecules assembled from smaller, individual molecules.

Answer: B)
3 0
3 years ago
Read 2 more answers
Other questions:
  • Raccoons will eat almost anything. They are most accurately called O carnivores O producers O herbivores O omnivores​
    9·2 answers
  • The growth plates are the weakest areas of the growing skeleton. They are even weaker than the nearby ligaments and tendons that
    7·2 answers
  • Which is a result of a seasonal change (meaning a change that happens over
    6·1 answer
  • What can be related to heat flow and movement of molten rock within the interior of the earth??
    6·1 answer
  • While in South America, you come across what you think are two groups of birds in the same location. They are nearly identical a
    6·1 answer
  • Why does it make biochemical sense that chaperones recognize hydrophobic surface area? What catastrophic event are chaperones me
    8·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What did Hershey and Chase work
    10·1 answer
  • What gives carbon the ability to form chains that are almost unlimited in length?
    13·1 answer
  • I need help w this it isnt the answer that is highlighted btw
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!