1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
STALIN [3.7K]
3 years ago
10

State the uses of excretory products in plants

Biology
1 answer:
d1i1m1o1n [39]3 years ago
3 0

state the uses of excretory products in plants

Carbon dioxide, excess water produced during respiration and nitrogenous compounds produced during protein metabolism are the major excretory products in plants. Plants produce two gaseous waste products i.e. oxygen during photosynthesis and carbon dioxide during respiration.

Hope this helps :)

You might be interested in
What type of volcano would you most expect to erupt?
BabaBlast [244]
A active volcano would mostly erupt.
5 0
2 years ago
Read 2 more answers
Ryan, an 8-year-old boy, has the habit of swallowing toothpaste. as a result, his teeth have become discolored. it can be said t
lorasvet [3.4K]
The answer to this question would be: excess fluoride intake

The toothpaste has a high amount of fluoride and will increase the blood fluor level. Excess fluoride intake in children can cause fluorosis which was the brown staining of teeth because fluor is deposited in the growing teeth. Fluorosis can happen in children with <8-year ages.


6 0
3 years ago
hawaii has formed on the pacific plate. hawaii is also over a hot spot thta allows magma to reach the surface of the earth, via
lana66690 [7]

Answer:

The northwest moving Pacific Plate has moved across the 'hot spot' that created the Hawaiian Islands for millions of years. This movement has left the northwest trending island chain

Explanation:

If the Pacific Plate keeps moving across the hot spot I believe Hawaii will keep becoming a bigger island because the Pacific plates movement caused Hawaii to form.

8 0
3 years ago
What are alleles?<br> different genes<br> same genes<br> different types of a genes
krok68 [10]

Answer:

Different types of genes

Explanation:

3 0
3 years ago
12. Integral proteins are located
adelina 88 [10]

Answer:

Integral membrane proteins are permanently embedded within the plasma membrane. They have a range of important functions. Such functions include channeling or transporting molecules across the membrane. Other integral proteins act as cell receptors

Explanation: HOPE U GET AN A HAVE A GREAT DAY!!!

6 0
3 years ago
Other questions:
  • Determine the mass, in grams, of 3.6 moles of angelic acid, C5H8O2
    11·1 answer
  • By signing the Kyoto Protocol, a country commits to decrease its greenhouse gas emissions. Which ecological issue does this prot
    6·1 answer
  • Within the cell energy is released at the
    13·1 answer
  • What is peer review?​
    13·1 answer
  • Which two elements share similar properties?
    6·1 answer
  • A subducted plate melts forming ____? A) magma and volcanic mountains B) the lithosphere
    15·1 answer
  • What element do nucleotides possess but proteins do not​
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which of the following glands are holocrineglands?
    6·1 answer
  • The diploid generation of the plant life cycle always _____.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!