1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergiy2304 [10]
3 years ago
10

The major difference between earth and other planets in our solar system is that

Biology
1 answer:
babymother [125]3 years ago
6 0

Answer:

Is that earth is the only planet with water and an atomoushpere that allows us to breath in

Explanation:

You might be interested in
Question 5
Maurinko [17]

Answer:

Cell membrane

Explanation:

Cell membrane controls what goes in and out of cells

3 0
2 years ago
Read 2 more answers
What are the names of the male and female reproductive organs?<br> What is asexual reproduction?
PilotLPTM [1.2K]
Male reproductive organs are testes
female reproductive organ is ovary


asexual reproduction --- process involving a single parent giving birth to an organism......their genetical elements are similar to each other's

HOPE THIS HELPED !!
4 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
A person who fakes symptoms for a goal is called a _________, while a person who fakes a disease for no clear goal has a _______
azamat

Answer:

A person who fakes symptoms for a goal is called a malingerer, while a person who fakes a disease for no clear goal has a factitous disorder:

Explanation:

Malingerer is someone who attempts to shirk or escape from duty/ responsibility by feigning. Malingering is the result of a person desire to gain a reward or avoid something and it is not caused by any physical factors. While Factitious disorder entails a person acting as if he or she has a physical or mental illness.

4 0
3 years ago
Read 2 more answers
Why are phrases such as tongue twisters, so hard to pronounce?<br> Please explain specifically.
zheka24 [161]
Simple, Your BRAIN can only process so much, so the signal to your vocal cords and tongue slow and You mess up Example:
 

SAY PETER Piper picked a pack a pickle peppers 8x

Did you mess up? I bet so

also here an easy one. RUBER BABY BUGGY BUMPER  
5 0
3 years ago
Other questions:
  • In anaerobic atp production, a byproduct of glycolysis is
    6·1 answer
  • When a microorganism such as e. Coli is grown on glucose, it is
    15·1 answer
  • What can you conclude about fossil by looking at the layers of rock?
    5·2 answers
  • What type of organism helps to reduce atmospheric carbon dioxide
    7·2 answers
  • What answer is this ?
    15·1 answer
  • Heeeelllpppppp please and thank you
    8·2 answers
  • Which of the following statements is true about the theory of plate tectonics and the theory of continental drift? A. The theory
    5·2 answers
  • Plssssss help meeeeeeeeeee
    7·1 answer
  • What has been the primary solution to problems presented by industrialization?
    13·1 answer
  • Fleas and mosquitoes sometimes transmit disease pathogens such as bacteria and viruses from one individual to another. Such agen
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!