All of the following are examples of destiny dependent limiting factors except

Biology

1 answer:

Triss [41]4 years ago

5 0

Hurricanes are not an example of density dependent limiting factors!

You might be interested in

Define: resistance (R)

docker41 [41]

It is the natural/genetic ability of an organism to avoid or repel attack by biotic agents (pests etc.) or to withstand the effects of abiotic agents example (chemicals).

6 0

3 years ago

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

3 years ago

During the conversion of glucose into a free form of energy only a small percentage is converted into useable ATP. What is the r

Yuki888 [10]

<h2>Adenosine triphosphate</h2>

Explanation:

ATP, or adenosine triphosphate, is synthetic vitality the cell can utilize.
The particle gives vitality to your cells to perform work, for example, moving your muscles as you stroll down the street.When ATP is separated into ADP (adenosine diphosphate) and inorganic phosphate, vitality is discharged.
ATP is converted into ADP which can be recycled back into ATP Is Converted into A waste product that The cell excretes ATP Is broken down into its individual parts and would need to be re-made Through metabolism to be used again.
At the point when one phosphate bunch is expelled by breaking a phosphoanhydride bond in a procedure called hydrolysis, vitality is discharged, and ATP is changed over to adenosine diphosphate (ADP).
ATP works as the vitality cash for cells. It permits the cell to store vitality quickly and transport it inside the cell to help endergonic concoction reactions.
As ATP is utilized for vitality, a phosphate gathering or two are withdrawn, and either ADP or AMP is created.

5 0

3 years ago

Chlamydia is often asymptomatic. Why might it be important for an individual to know if he or she were infected?

Tatiana [17]

Chlamydia is a disease transmitted by sex with someone infected. Its caused by bacteria and often is asymptomatic.

Treatment is with antibiotics, and it's essential to know if one is infected because in women can cause infertility, and in males can cause urethra complications like inflammation and obstruction.

3 0

3 years ago

____ is an Inheritance pattern in which a tralt is controlled by many genes.

Ne4ueva [31]

Answer:

Eye colour

Explanation:

Eye colour is passed by your parents, what ever colour they have will determine what the child would have

If it was like two brown eyes the child would have brown eyes

If it was two different colours whatever colour which is more dominent will detirmen the colour of the child's eye

8 0

3 years ago