1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hoochie [10]
2 years ago
10

To investigate a possible relationship between two factors, such as acidity and solubility, you must first identify the variable

s involved in the experiment. Identify the independent variable, the dependent variable, and any possible confounding variables within this experiment.
Biology
1 answer:
Lyrx [107]2 years ago
3 0

Independent variables cause an effect in another variable (<em>acidity, pH</em>). Dependent variables respond on any change in the independent one (<em>solubility</em>). Confusing variables can influence the results if not controlled (t<em>emperature, pressure, surface contact)</em>.

------------------------

Before conducting an experiment, first, the researcher needs to identify the study groups –<em>experimental and control groups</em>- and the variables involved.

  • Independent (manipulated) variable: Refers to all the variables in an experiment that provoke a response in another variable. The researcher changes it on purpose to observe the response of the dependent variable.
  • Dependent variable: Refers to the variable, which response depends on any change in the independent variable. The response might be proportional or inversely proportional to the change in the manipulated variable.

Usually, many factors influence or affect the response of the dependent variables. Most of them are not of interest to the researcher.

  • Confusing variables or confusing factors are closely related to both <em>the dependent and the independent</em> variables, but they are not of interest in themselves. <em>These factors might  </em><em>mask </em><em>the actual </em><em>effects </em><em>of the</em><em> independent </em><em>variables on the </em><em>dependent </em><em>one,</em> causing miss interpretations of the results.  

The researcher needs to identify all possible confusing variables and keep them constant.

  • Controlled variables are kept constant in the control groups and the experimental groups. Unlike the independent variable, the controlled variables do not influence the results. These variables do not affect the response of the dependent variable.

For instance. You want to study the relationship between solubility and acidity.

  • The independent variable is acidity, which is one of the factors that affect solubility.
  • Solubility is the dependent variable, which responds to the acidity of the solvent.

But solubility also depends on many other factors, such as <em>surface contact, temperature, pressure, and agitation</em>. They are not of interest in this study, but <em>if you do not get to control them, you will not be able to </em><em>discriminate </em><em>the effects of pH from the effects of all these factors</em>.

These are confusing factors, and you need to keep them constant in all your study groups. Only then you will see the real effects of pH on solubility.

----------------------------------------

Related link: brainly.com/question/1479694?referrer=searchResults

You might be interested in
Don marquis thinks abortion is almost always wrong because (most) fetuses ___________________.
myrzilka [38]

Don marquis thinks abortion is almost always wrong because (most) fetuses loose a bright and valuable future.

<h3>What is Abortion?</h3>

The term "abortion" refers to the removal or evacuation of an embryo or fetus in order to end a pregnancy. Miscarriages, also known as "spontaneous abortions," are abortions that take place naturally and happen in 30% to 40% of pregnancies. An induced abortion, or less frequently "induced miscarriage," is when pregnancy is intentionally ended. Abortion, when used without modification, typically refers to an induced abortion.

Induced abortion is one of the safest medical treatments when performed correctly. The probability of maternal death in the US is 14 times lower following an induced abortion than following childbirth. Unsafe abortions—those carried out by practitioners without the required training or in circumstances with insufficient resources.

Learn more about Abortion with the help of the given link:

brainly.com/question/11476637

#SPJ4





4 0
2 years ago
How does a net force of zero affect an object state of motion
enot [183]
Çok sıkıldım ya okul bitti hala ödevmi yapıyosunuz
8 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
A man is 1.7 m long. An amoeba is 17 um long. How does the length of the
grandymaker [24]
A man is 100,000 times larger in micrometers than the amoeba, since 17 micrometers is 0.000017 meters, and 1.7 meters is 1,700,000 micrometers
5 0
3 years ago
How does society affect science? Check all that
Lana71 [14]

Answer:

The correct answer is probably A: The needs of society help determine the types of research conducted.  For example, people are more likely to research ebola when there is an outbreak, right?  B isn't true: for example, society doesn't let scientists experiment on unwilling humans!  C is probably true, but it is more specific than A--that is, C only applies in certain cases.  Society ALWAYS applies to science.  D isn't correct either: society encourages research for the greater good,

Explanation:

7 0
2 years ago
Read 2 more answers
Other questions:
  • You are an oxygen molecule floating in the air near a rabbit about to pass into its nasal passageways. Tell the story of your ad
    9·1 answer
  • PLEASE HELP. ILL GIVE BRAINLIEST
    15·1 answer
  • What are two homeostasis mechanisms of focus?​
    7·2 answers
  • 11. Which of the following is NOT thought of as surface water in the hydrosphere?
    15·2 answers
  • Which of the following is not a reason plants need to consume water
    15·2 answers
  • What type of property cannot be seen just by observing with senses
    11·1 answer
  • The____groups related species
    11·1 answer
  • Imagine that you're able to fully dissolve a powdered substance in water
    10·1 answer
  • During receiving of a food order, you notice a bag of rice with signs that the bag has been wet. What do you do?
    7·1 answer
  • In which city is the Gujarat High Court situated?<br><br>​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!