1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexira [117]
2 years ago
7

Which of the following statements is true?

Biology
2 answers:
Veseljchak [2.6K]2 years ago
8 0

Answer:

Option C. Viruses are bundles of genetic material enclosed in a capsid.

Explanation:

Option A- False - Bacteria is about 100x larger than viruses.

Option B- False - Viruses aren't cells since they aren't living organisms.

Option D- False - Viruses are not living organisms.

max2010maxim [7]2 years ago
4 0
Viruses are bundles of genetic material enclosed in a capsid.
You might be interested in
As hominids evolved, their brain size<br> decreased in capacity.<br> False<br> True
zubka84 [21]

Answer:

Explanation:handcuffing jgfxgjdxgjfx

3 0
2 years ago
Read 2 more answers
What is the benefit of dna taking the shape of a double helix
olya-2409 [2.1K]
<span>The most important role of this peculiar double helix structure of DNA is to facilitate replication....in preparation of cell division each of the 2 strands acts as a template thus facilitating precise copying of genes....in the Nature(1953), </span>
7 0
2 years ago
Read 2 more answers
In 2008, scientists in France discovered that a virus was capable of infecting another virus. Which theory might be supported by
Salsk061 [2.6K]

Viruses (Biology)


In In 2008, scientists in France discovered that a virus was capable of infecting another virus. Which theory might be supported by this information?


Answer: A virus is living.


<span>I hope this helps, Regards.</span>

8 0
2 years ago
Organisms inherit specific traits and characteristics from their parents. Albinism is an inherited disorder that occurs when an
lisov135 [29]

Answer: B. Genes

I hope that this helps you !

6 0
2 years ago
Someone plzzzz plzz plz help me I’ll cash app 100$ to whoever gets it right ! Plz
liubo4ka [24]

Answer:

Don't cashapp me but im guessing BB just wait for other people to answer bc im not a 100% sure

Explanation:

4 0
2 years ago
Read 2 more answers
Other questions:
  • A patient underwent debridement of the acromion, subacromial bursectomy, division of the coracoacromial ligament, and an abrasio
    12·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A mutation occurs in the eye cell of a rat. the mutation stops the gene from producing the protein that builds part of tge eye.
    8·1 answer
  • In a biology class, one student argues that tissues are the building blocks of organs. Another student argues that cells are the
    9·2 answers
  • Help pls i mark as brainlist answer all 4
    8·1 answer
  • Which type of fatty acid would result in a lipid that is the most liquid?
    10·1 answer
  • The five most prominent pools where carbon is stored include the Earth's crust, oceans, soil, atmosphere, and the ________.​
    15·2 answers
  • Can someone help 6th grade science ASAP PLEASE IM BEING TIMED
    7·1 answer
  • C + O2 = CO2
    7·1 answer
  • Hello, timed test. please help !
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!