1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VARVARA [1.3K]
3 years ago
12

50 POINTS, NEED THE ANSWER RIGHT NOW, WILL MARK THE BRAINIEST- During DNA replication, the strand is synthesized in the 5′ to 3′

direction. The strand that runs away from the replication fork is synthesized in because .
Biology
2 answers:
Triss [41]3 years ago
6 0
As the fork moves forward, the DNA polymerase must come off and reattach on the newly exposed DNA.
Fed [463]3 years ago
5 0

Answer:

leading, in fragments, DNA polymerase cannot synthesize to the 3' to 5' direction

Explanation:

I took the test and got all of them right!!!!

You might be interested in
As a volcano erupts, it produces lava. As this lava flows, it cools down and hardens, forming a rock. How could you classify thi
Fittoniya [83]

Answer:

igneous

Explanation:

3 0
4 years ago
The perception of an image first, followed by noticing individual pieces of the
lakkis [162]

Answer:top-down

Explanation:

5 0
3 years ago
Read 2 more answers
What is the complementary DNA of TACCGGATGCCAGATCAAATC?
Liono4ka [1.6K]

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary <u>DNA strand</u>.

7 0
4 years ago
When a normal cell undergoes mitosis it produces two, identical cells that are clones of the “mother” cell. How is that differen
maks197457 [2]

Answer:

when a sex cell undergoes meiosis, it producs two haploid cells each having half the chromosome number of the "mother" cell

6 0
3 years ago
The stretch hold is a restraint technique:
olchik [2.2K]

Answer:

Option B,

Explanation:

Proper restraint and handling techniques are used while dealing with animals in laboratory. These techniques ease the process of dealing with animals and must be practiced on regular basis even when there is no procedure being performed.  

Unlike other animals cat is the most co-operative animals and it is usually dealt by restraining the body be one hand and head by other hand. Cats can also be restrained by holding the scruff with one hand and then gently holding the hind limbs followed by stretching it.

Hence, option B is correct.

7 0
3 years ago
Other questions:
  • What biomes are found in Southern Africa
    13·1 answer
  • Which of the following is a unit of measurement in the metric system?
    9·2 answers
  • SOMEONE HELP PLEASSE!
    11·1 answer
  • the chloroplast, a tiny body within plant cells, is the power generator for life on earth true or false
    7·2 answers
  • Dna sequences in bacteria that on rare occasions moved from one place in the genome to another are called ________.
    13·1 answer
  • Galaxies whose shape seems to follow no set pattern are classified as
    6·2 answers
  • When electrons of a chlorophyll molecule are raised to a higher energy level, they?
    8·1 answer
  • What process is used to form polymers from monomers
    11·1 answer
  • What is the most common source of errors during the Gram stain procedure?
    9·1 answer
  • One strand of a DNA molecule has the base sequence ATAGGT. The complementary base sequence on the other strand of DNA will be..
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!