1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SVETLANKA909090 [29]
3 years ago
7

the chloroplast, a tiny body within plant cells, is the power generator for life on earth true or false

Biology
2 answers:
Mrrafil [7]3 years ago
7 0
Well, in a way it is true, as, chloroplasts are the reason why plants photosynthesize. So, with the photosynthesis, it releases oxygen, which is the power generator for life on Earth, as we breathe in oxygen.
Leno4ka [110]3 years ago
7 0

Answer:

True

Explanation:

The source of the majority of all energy on earth starts with plants who use chloroplast to absorb the suns energy.

You might be interested in
Briefly explain y genetic variation is important to living organisms <br><br>plz help​
Nesterboy [21]
So if one organism can’t adapt to its environment then the other can. So their population doesn’t decrease
4 0
3 years ago
Look at fig. 132 where the Punnett square shows a homozygous red grapfruit
sp2606 [1]

Answer:

kljgy

Explanation:

7 0
3 years ago
This transportation process requires the cell to move particles from low concentration to high concentration. active transport f
ipn [44]

Answer:

During active transport, substances move against the concentration gradient, from an area of low concentration to an area of high concentration. This process is “active” because it requires the use of energy (usually in the form of ATP). It is the opposite of passive transport.

Explanation:

This may help you out! :)

7 0
3 years ago
Read 2 more answers
Which tool would be likely to provide the most accurate measurement of time in a laboratory experiment involving sprinting times
Ket [755]
A stopwatch would provide the most accurate measurement when sprinting
6 0
3 years ago
Select all that apply.
ArbitrLikvidat [17]
Pollen....because cones are absent in angiosperms.....flowers are absent in gymno....and seeds are also absent in gymno sperm........so and is pollen !
6 0
3 years ago
Read 2 more answers
Other questions:
  • A population’s size in unaffected by the available resource supply. True or false
    8·2 answers
  • Differentiate between the habitat and niche of an organism that is found in your community
    8·1 answer
  • how do i turn the following into something that will give me a month of data? "how does caffeine affect the human body blood pre
    6·1 answer
  • What does animal cells have that plant cells don't have?
    15·1 answer
  • What is the important thin about cell cycle
    11·1 answer
  • A fertilization<br>B prophase II<br>C polyploidy<br>D crossing over​
    10·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which of the following organisms makes its own food using light energy from the sun?
    6·2 answers
  • Do both plz
    7·1 answer
  • What is the independent and dependent variable of sand sifting.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!