It provided people with 1 of their most basic needs, a dependable supply of food
Answer: Option B - There are more than four genes that determine this trait.
Explanation:
The tobacco plant species have its leaf colour with characteristics that changes gradually over a range of values, which refers to continuous variation.
Note that continuous variation keep expressing gene variants in successive generations of the tobacco plants, that differs from the parents. So, there are MORE THAN four genes controling the expression of varying phenotypes in the leaves
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Sedimentary rock forms *over time,* which means that those rocks had to form over millions of years, proving that the Earth has been forming and changing all this time.
Awnser is d hope this helps