1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergeeva-Olga [200]
3 years ago
14

A primigravid client at 38 weeks’ gestation comes to the labor room because “my water broke.” the health care provider (hcp) ask

s the nurse to verify spontaneous rupture of membranes using nitrazine paper. the nurse observes that the nitrazine paper turns bright blue. the nurse’s next action should be to:
Biology
2 answers:
AlladinOne [14]3 years ago
6 0

Call for immediate assistance in the client's room.

Anastaziya [24]3 years ago
4 0
<span>38 weeks is early, the full term is typically 40 weeks. Nitrazine paper is a sensitive test of pH and will turn blue in the alkaline fluid. While that can happen for a number of reasons, one of them is that amniotic fluid will turn nitrazine paper bright blue indicating that the membranes have ruptured. Preterm labor management should be started.</span>
You might be interested in
What is metopus, and what type of endosymbiont does it keep?
sesenic [268]

Answer:

Hey i think there is an error in ur question, u may recheck the so called word "metopus"

But here is the definition of Endosymbionts are organisms that form a symbiotic relationship with another cell or organism

7 0
2 years ago
Why do pond organisms live in shallow water ?
Trava [24]
Pond organisms live in shallow water so they can produce
8 0
3 years ago
What are models scientists use to research a disease
JulijaS [17]

Explanation:

i dont reaa!aaaaallllllleeeey nxkdhskdnf

4 0
3 years ago
Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For thi
Likurg_2 [28]

Answer:

DNA: ATGGGGGCGATATTTTATCCGACG

RNA: AUGGGGGCGAUAUUUUAUCCGACG

Protein: MGAIFYPT

Explanation:

Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.

7 0
3 years ago
What does translate mean in biology
maw [93]

Answer:

Translation is a step in protein biosynthesis wherein the genetic code carried by mRNA is decoded to produce the specific sequence of amino acids in a polypeptide chain. 

4 0
3 years ago
Other questions:
  • ATP is thermodynamically suited as a carrier of phosphoryl groups in animal cells because of all EXCEPT ________.
    14·1 answer
  • Coal, a nonrenewable resource, is the most abundant fossil fuel produced in the United States. Although environmental laws and m
    11·2 answers
  • Need help on checking my answers! The ones circled in yellow are the ones that I believe the answers are. Please and thank you (
    9·1 answer
  • Approximate efficiency of the conversion of light energy to chemical energy in photosynthesis
    6·2 answers
  • Which of these situation would tend to cause absorption of the largest amount of solar energy
    7·1 answer
  • In which stage of the plant’s life cycle should he check whether a significant number of adult ants are acting as pollinators?
    14·1 answer
  • The endocrine system regulates the body through hormone release. Like the nervous system, what does the endocrine system help ma
    6·1 answer
  • Diagram (A) depicts limbs that evolved from the front limbs of a common ancestor whose bones resembled those of an ancient fish.
    12·1 answer
  • What is the main feature of primary succession
    14·1 answer
  • What is the answer to the question
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!