1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
larisa [96]
3 years ago
11

How to describe race?​

Biology
1 answer:
pogonyaev3 years ago
3 0

Answer:

Race refers to a person's physical characteristics, such as bone structure and skin, hair, or eye color. Ethnicity, however, refers to cultural factors, including nationality, regional culture, ancestry, and language. ... You can have more than one ethnicities but you are said to have one race, even if it's "mixed race".

Hope this helps !

You might be interested in
A one liter jar is filled with water right to the top. A rock is then dropped in the jar and 600 mL of water is displaced (pushe
bulgar [2K]

The rock will only displace the same amount of water that the rock's volume is.


1mL = 1cm^3


400mL = 400cm^3.


7 0
3 years ago
Read 2 more answers
If Y = -2 bars and Ys = +2 bars, then Wp =​
Tcecarenko [31]

Answer:

?

Explanation:

5 0
3 years ago
HELP ASAP<br><br> i don’t know if even my puzzle pierce is correct
Wewaii [24]

Answer:

Your answers are included in the picture attached below..

Explanation:

Self reliant is correct.

Problem solvers would be matched with the third one on the right side.

innovators would match with the first one on the right side

inventors would be matched with the one across from it, or the last one on the right side...

Hope this helps! Brainliest would be much appreciated! Have a great day! :)

8 0
2 years ago
Jeremiah is an 10-year-old male who is short in stature. His parents have become concerned as Jeremiah is now wetting the bed, d
joja [24]

Answer: 2) Tests used to diagnoses diabetes: Oral Glucose Tolerance Test, Fasting Glucose Test, Hemaglobin A1c, Random Blood Suger Test.

3) unexplained weight loss, frequent unination, lethargic, excessive thirst, nausea , and vomititng, increased hunger even though is still eating, blurry vision, bed-wetting in childern who did not do it previously, dry mouth,

Explanation:

7 0
3 years ago
2. Most mutations are "silent." What does this mean?​
Zielflug [23.3K]

Explanation:

Silent mutations occur when the change of a single DNA nucleotide within a protein-coding portion of a gene does not affect the sequence of amino acids that make up the gene's protein.

8 0
3 years ago
Other questions:
  • Why are there so many do breeds?
    12·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What molecule is represented by the molecular model shown below?
    10·1 answer
  • What is a test variable? Give an example
    12·1 answer
  • Which is a factor in how a species can change over time?
    5·1 answer
  • Cardiac muscle fibers function to:
    8·1 answer
  • In a Hardy-Weinberg population with two alleles, A and a, that are in equilibrium, the frequency of allele a is 0.1. What is the
    5·1 answer
  • Help with this??<br> Aaaaaaa
    12·1 answer
  • Describe how and where viruses reproduce and the function of RNA and DNA in this process.
    9·1 answer
  • In which city is the Gujarat High Court situated?<br><br>​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!