1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Delicious77 [7]
3 years ago
11

Numerous dry salt flats now in existence are the remains of isolated ___ which were left over to evaporate from the salt water.

Biology
1 answer:
Neporo4naja [7]3 years ago
6 0
It has to be lakes or rivers
You might be interested in
Plutchik suggested we have ____ primary emotions that combine to form secondary emotions.
kondor19780726 [428]
Plutchik suggested we have 8 primary  emotions that combine to form secondary emotions. Putchik identified ten postulates on which his evolutionary theory of emotions is based. Plutchik's wheel of emotion illustrates the relationships between his primary emotions and other related emotions. The eight basic emotions are joy, trust, fear, surprise, sadness, anticipation, anger, and disgust.
4 0
2 years ago
Hereditary information for most traits is generally located in
Paha777 [63]

genes on chromosomes

3 0
3 years ago
PLEASE HELP- SCIENCE
Effectus [21]

Answer:

A

Explanation:

gregor Mendel experimented on plants and was able to discover genes, chromosomes.

7 0
3 years ago
Which one of the following events occurs first in a nerve impulse
bazaltina [42]
<span>Since you left off the choices, I have to just present the facts of what occurs first in the nerve impusle. The first thing that will is happen is the sodium ios will move to the inside of the nueron. The second step is the potassium ions will move to the inside of the neuron. After those move into the nueron, calcium will then move into the nueron. Both the sodium and potassium have 1 postive charge. While the calcium ion has 2 positive charges. </span>
5 0
3 years ago
Most of the carbon dioxide produced by humans is ________.
Neko [114]

Answer:

used by plants

Explanation:

5 0
3 years ago
Other questions:
  • Which events take place in the light-dependent reactions of photosynthesis?
    7·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • describe how natural selection can sometimes lead to persistence of harmful or even lethal allele include exampple
    13·1 answer
  • Strawberries can reproduce by means of runners, which are stems that grow horizontally along the ground. At the region of the ru
    10·1 answer
  • The opening of a _______ channel is controlled by the binding of some molecules to the channel.
    15·1 answer
  • Which of the following are important uses of genetic maps?
    14·1 answer
  • in your opinion, should there be a uniform set of regulations that labs should follow when they are developing genetically modif
    5·1 answer
  • Can someone help me? The question is State two scenarios that demonstrate the process diffusion​
    10·1 answer
  • The Small channels of spongy bone that are filled with marrow are most accurately named ______.
    11·2 answers
  • What is draco named for?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!