1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
k0ka [10]
3 years ago
11

How does the absorption of ultraviolet radiation by the ozone layer help sustain life? a. This process helps maintain the temper

ature of the Earth. b. It keeps a low level of harmful ultraviolet radiation from reaching living organisms. c. This process keeps ozone concentrations in the troposphere at lower levels. d. All of the above are true.
Biology
2 answers:
Jet001 [13]3 years ago
8 0

the answer to the  question is D

larisa86 [58]3 years ago
7 0
The correct answer is D.
You might be interested in
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
In the boxes below, fill in the appropriate neuron parts, structures, or functions.
dolphi86 [110]
Here is you answersjshehebdbdhhdd

3 0
3 years ago
Which type of RNA carries a genetic code from DNA to the ribosome?
Aliun [14]

Answer:

(A). mRNA.

Explanation:

During protein synthesis, information present in DNA as triplet codons gets transferred to mRNA molecule, by the process of transcription. The mRNA than gets transported to the cytosol, where it associates with ribosomes.

Ribosomes are known as protein factories of the cells as they provide platform for translation. During translation, information present in mRNA is used to translate polypeptide chain or protein as each codon codes for a specific amino acid.

Thus, the correct answer is option (A).

6 0
4 years ago
What are all the countries that were affected by the black death?
Likurg_2 [28]
France Germany England and Italy hope this helps
5 0
3 years ago
N NaO2, what does the 2 represent?
Viktor [21]

Answer:

In the element (<u>n Na20)</u> the <em>2 </em>means that there are 2 oxygen atoms in the Sodium Oxide.

7 0
3 years ago
Other questions:
  • How does blood osmolarity compare between the two treatment groups?
    15·2 answers
  • Why would a third-degree burn be less painful than a first- or second-degree burn involving the same body area?
    6·1 answer
  • 10 POINTS ANSWER FAST PLZ
    10·1 answer
  • What is the name of the substance that gives skin and hair its pigment?
    11·1 answer
  • Taxonomy is an organizing science used in _____.<br> 8<br> zoology<br> botany<br> all of these
    9·2 answers
  • Which of the following lists, in correct order, the phases of interphase? View Available Hint(s) G1, A) prophase, and S Prophase
    10·1 answer
  • Which statement accurately describes an interaction between plants and animals? A. Animals release O2, required for plant surviv
    15·2 answers
  • SOMEONE PLZ HELP ME!!!!!!!!!!!!!!!
    13·2 answers
  • What does the foucault pendulum tell us about earth?
    13·1 answer
  • The DNA molecule is conformed by a sugar named: _______________, a ___________________ and a _______________ ______________ (___
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!