Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Here is you answersjshehebdbdhhdd
Answer:
(A). mRNA.
Explanation:
During protein synthesis, information present in DNA as triplet codons gets transferred to mRNA molecule, by the process of transcription. The mRNA than gets transported to the cytosol, where it associates with ribosomes.
Ribosomes are known as protein factories of the cells as they provide platform for translation. During translation, information present in mRNA is used to translate polypeptide chain or protein as each codon codes for a specific amino acid.
Thus, the correct answer is option (A).
France Germany England and Italy hope this helps
Answer:
In the element (<u>n Na20)</u> the <em>2 </em>means that there are 2 oxygen atoms in the Sodium Oxide.