Answer:
Male gametes / microspores are produced in pollen cones and develop into pollen grains. Some gymnosperm species have male and female cones on the same tree, while others have separate male or female cone producing trees. ... Fertilization in gymnosperms occurs when pollen grains contact the female ovule and germinate. I hope dis helps :3
Cytotoxic T cells are rapid killers of infected target cells. Within minutes of the interaction of a cytotoxic T cell with a target cell, the program of apoptosis in the target cell is initiated. This rapid activity is a consequence of The extremely rapid production of granzymes and perforin by cytotoxic effector cells upon encountering a target cell.
- A type of T cell known as a cytotoxic T cell (CD8+ T cell) is in charge of removing things that the immune system recognizes as dangerous.
- Cytotoxic T cells are essential for controlling bacterial growth and illnesses in the body.
- By instructing their targets to undergo apoptosis, cytotoxic T lymphocytes kill their prey.
- Cytotoxic T cells can instruct antigen-specific target cells to die within 5 minutes of coming into contact with them when they are mixed with target cells and quickly brought into contact by centrifugation.
- The speed with which cytotoxic T cells can induce apoptosis in their targets is due to the release of prepared effector molecules that trigger the target cell's own endogenous apoptotic pathway.
learn more about Cytotoxic T cells here: brainly.com/question/9292555
#SPJ4
Answer:
1. Each Giraffe's neck length is different
2. The tall neck Giraffes reproduced and their off spring inherited their genes
3. A drought occurred.
Explanation:
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
