1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
JulijaS [17]
3 years ago
13

What property of a hormone would allow it to pass unassisted through a plasma membrane?

Biology
1 answer:
siniylev [52]3 years ago
8 0

Ans.

Hormones are regulatory substances synthesized by various plants and animals and play role in proper growth, development, and maintain homeostasis. Hormones are released by signalling cells and show their actions after binding to specific receptors present on the surface or inside of the target cell.

Hormones, for which receptors are present inside the cells (in cytosol or nucleus) should be hydrophobic in nature. This is because plasma membrane is made up lipid molecules and small, hydrophobic, uncharged molecules can easily pass through this. For example, cortisol, estrogen, and progesterone hormones are lipid-derivatives and receptors for these hormones are present inside the cells.  


You might be interested in
This phase is known as _____<br><br> p
MAXImum [283]

Answer:

phillip?

Explanation:

8 0
3 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
A cart was pulled across a table with a force of 3.0N.The acceleration was 1.5m/s². Determine the mass of the cart.
Elenna [48]

Answer:

2kg

Explanation:

Force (N) = mass (kg) × acceleration (m/s²). Thus, an object of constant mass accelerates in proportion to the force applied.

8 0
2 years ago
Which of the following is the average height of the ocean’s surface between high and low tides?
Oxana [17]
The average height of the oceans surface between high and low tides is called the sea level. It is important to know this measurement because with this it is possible that we can calculate the height of anything on the land. Also, we can <span> calculate the height of anything on the land. Also, we can be able to determine whether the oceans are falling or rising through time. 

So the answer is </span><span>Sea level </span>
4 0
3 years ago
Read 2 more answers
The orange color of carrot roots and marigold flowers comes from cell bodies known as chromoplasts. True False
aliina [53]
<span>The question says,'the orange colour of carrot roots and marigold flowers comes from cell bodies known as chromoplasts. The statement is true. Chromoplasts are coloured plastids, they usually contain a yellow or orange pigment. They can be found in roots, leaves, fruits and ageing leaves and are responsible for the distinctive colours of these plant parts.</span>
3 0
2 years ago
Other questions:
  • What is the difference between a millipede and a centipede?
    12·2 answers
  • Scientists discovered that the Albert's squirrels became two separate populations during the Grand Canyon's formation; they are
    13·1 answer
  • What will result in a decrease of gfr?
    10·1 answer
  • Which of the following cells are produced through meiosis?
    10·1 answer
  • Tom is going to buy two hamsters. He wants to breed them and sell the baby hamsters to a local pet store. The store owner tells
    8·1 answer
  • During reduction, PGA reacts with ATP and NADPH. What does ATP contribute to the reaction?
    8·2 answers
  • What causes different versions of the myostatin protein
    14·1 answer
  • Which of the following will cause a decrease in ADH production?
    8·1 answer
  • Which substance in chloroplasts is a green pigment that absorbs energy for
    13·2 answers
  • how does sustainable development supports the appropriate use of natural resources and long lasting development?​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!