1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina-Kira [14]
3 years ago
7

Horses and donkeys can mate, but they produce a mule, which is always a sterile animal. This means that they cannot produce viab

le offspring and are reproductivelygeographicallytemporallybehaviorally isolated.
Biology
2 answers:
Lemur [1.5K]3 years ago
8 0

Answer : The correct answer is-

This means that they cannot produce viable offspring and are reproductively isolated.

Mule (which is a sterile that is infertile animal) is produced by mating of horse and donkey.

According to Biological species concept of Ernst Mayor, a group of organism belong to same species if they produce viable and fertile offspring.

This means that organisms belonging to different species are reproductively isolated that is unable to produce viable and fertile offspring.

Thus, reproductively isolated is the right answer.

Lubov Fominskaja [6]3 years ago
3 0
reproductively
hope this helps!
You might be interested in
Helpppppp meeeeeeereeeeeeee
romanna [79]

Answer:

how

Explanation:

how do u want me to help u just tell

7 0
2 years ago
Do you think the challenge society faces with regard to feeding the world's growing population is an example of ecological carry
Minchanka [31]

Answer: Yes

Explanation:

Carrying capacity can be defined as the total number of members of the population of a species that an ecosystem can sustain in terms of providing resources in the form of food, shelter and others. When the resources are available in surplus then the population of a species increases exponentially but declines when resources become scarce. The human population is increasing tremendously all over the world this is supported by the resources like food, water, fossil fuels, air, minerals, and others. But some of these resources are decreasing due to overuse and may not be available in future to sustain the future generation.

7 0
2 years ago
A client has been given a prescription to begin using nitroglycerin transdermal patches for the management of angina pectoris. w
11Alexandr11 [23.1K]
Several things; don't use multiple patches, never take an ED medication (Erectile Dysfunction), if sign and symptoms including those of hypotensive reading, go to the emergency room.
4 0
3 years ago
Compare and Contrast Mitosis and Meiosis
pshichka [43]

Answer: Meiosis is sexual, occurs in humans, plants, animals, and some fungi, and creates sex cells.

Mitosis is asexual, creates organisms that are genetically identical. Basically a copy of themselves.

Hope this helped!

7 0
3 years ago
What is the function of the cell membrane
Sauron [17]

Answer:

The plasma membrane, or the cell membrane, provides protection for a cell. It also provides a fixed environment inside the cell, and that membrane has several different functions. One is to transport nutrients into the cell and also to transport toxic substances out of the cell.

Explanation:

3 0
2 years ago
Other questions:
  • What is ecology? Why does it matter?
    12·2 answers
  • The study of living things and their environment is called<br> What is it
    9·2 answers
  • A horizontal line on the velocity vs. time graph indicates a constant, positive acceleration.
    6·2 answers
  • The bacteriologist Sir Alexander Fleming was engage in the study of staphyococcus a kind of bacteria that wa being grown in petr
    7·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Select the correct answer.
    14·1 answer
  • Scientists group materials together ________ it is easier to compare and study them that way
    15·1 answer
  • I’m finna fail if I don’t get answer please help
    7·2 answers
  • 12ompaataampoanriias<br> testation<br> arning soon<br> Pooradamma<br> Conceing the site
    5·1 answer
  • Petra is working on a project that is looking for ways to improve milk yield in cows. What is Petra's job title?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!