1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
notsponge [240]
3 years ago
9

Tonic-clonic seizures are also known as _______ events.

Biology
2 answers:
Andreas93 [3]3 years ago
8 0
Tonic-clinic seizures are known as ictal events
puteri [66]3 years ago
7 0
Tonic Clonic seizures are also known as_______ events.


Answer: ictal events


Good luck and have a nice Benevolentpuppy day

You might be interested in
When a capillary is damaged, a platelet
Sauron [17]

Answer:

B. Positive Feedback is the answer

4 0
3 years ago
T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?
Leya [2.2K]

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

<h3>What is a sense DNA strand?</h3>

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

brainly.com/question/1048150

8 0
3 years ago
What are the two ways the hypothalamus sends messages to the pituitary gland?
Arturiano [62]
The hypothalamus synthesizes and secretes certain hormones called releasing hormones which stimulate the secretion of pituitary hormones.

The hypothalamus gland uses the nervous system and secretes hormones which sends messages to the pituitary hormones.


4 0
4 years ago
A medical student makes a transverse cut of a cadaver's leg. The two resulting sections could be referred to as the
Gelneren [198K]
A transverse section cut is a cross section took by slicing, really or through imaging techniques, the body or any part of the body structure, in a horizontal plane, a plane that crosses the longitudinal axis at a right angle. In other words, it divides the body into superior and inferior parts which is also known as the top and bottom parts.
8 0
4 years ago
Which type of electromagnetic radiation is the primary cause of sunburns?
snow_lady [41]
Ultraviolet rays cause sun burns
7 0
3 years ago
Read 2 more answers
Other questions:
  • Starting from school, you bicycle 2 km north, then 6 km
    6·1 answer
  • What is a similarity between wind and water?
    6·2 answers
  • What is the difference between food chains and food webs?
    7·1 answer
  • 9)
    7·1 answer
  • What are the major contributions of Ptolemy, Copernicus, Kepler, and Newton to the current structure of the solar system?
    14·1 answer
  • You are studying transplant rejection in a wild and genetically diverse population of mice. You have captured some of the mice f
    8·1 answer
  • Why aren’t descriptive investigations relatable
    6·1 answer
  • Which of the following is NOT true regarding a scientific theory?
    15·1 answer
  • The whole universe was once held in a zone called the...
    5·1 answer
  • The picture illustrates three cross sections of rock layers from three different areas.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!