Answer:
B. Positive Feedback is the answer
The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
The hypothalamus synthesizes and secretes certain hormones called releasing hormones which stimulate the secretion of pituitary hormones.
The hypothalamus gland uses the nervous system and secretes hormones which sends messages to the pituitary hormones.
A transverse section cut is a cross section took by slicing, really or through imaging techniques, the body or any part of the body structure, in a horizontal plane, a plane that crosses the longitudinal axis at a right angle. In other words, it divides the body into superior and inferior parts which is also known as the top and bottom parts.
Ultraviolet rays cause sun burns
