1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
QveST [7]
4 years ago
10

"identify the correct order of events that allow nutrients from foods to be used by the body."

Biology
2 answers:
dybincka [34]4 years ago
5 0

Answer:

The correct sequence of events are: Ingestion - Digestion - absorption - assimilation

Explanation:

Ingestion: It is the process of taking either solid or liquid food through mouth or oral cavity.

Digestion: It includes the digestive system which consists of alimentary canal and the associated glands. These glands help in the digestion of food. Alimentary canal starts with mouth and opens outside through anus. Complete digestion of food occurs in small intestine.

Absorption: Once the food is completely digested in small intestine it must be absorbed across the intestinal wall into the blood stream or lymph.

Assimilation: The absorbed substance then finally reaches the tissues which utilizes them for activity.

erik [133]4 years ago
4 0
<span>digestion, absorption, transport, elimination</span>
You might be interested in
HELP ASAP!!! Which of the following is a genotype?
cluponka [151]
C.tt is the correct answer

8 0
3 years ago
Which of the following are found in plant cells, but not in animal cells? Pick three.
galben [10]
Alarge vacuoles cell walls and chloroplasts
5 0
3 years ago
Read 2 more answers
In a cell that is not dividing, the unwound, filamented mass of dna and associated proteins is(are) called
kozerog [31]

Answer:

Chromatin

Explanation:

The unwound, filamented mass of DNA and associated proteins in a cell that is not dividing id termed as 'chromatin'. The major function of the chromatin is to pack the DNA into the compacted dense shape so that any type of tangling is avoided in the DNA strands. The chromatin is known to be present in every eukaryotic cell. It is due to chromatin that the chromosomes are properly segregated during the anaphase. The nucleus is the site where chromatin is present.

7 0
3 years ago
How are rocks DIFFERENT from minerals?
ArbitrLikvidat [17]
A mineral is a naturally occurring, inorganic compound with a unique chemical structure and physical properties. A rock is a solid, stony mass composed of a combination of minerals or other organic compounds. For example, quartz and feldspars are minerals, but when formed together, they make a rock, granite.
6 0
4 years ago
Read 2 more answers
What type of environmental conditions do the camera systems need to withstand for three years?
nikklg [1K]

Cameras and video-shooters are essentially tough. They can withstand a lot, from insects to shark bites. However, in order to withstand being outside for such a long time of three years? That's a little tricky.

As we all know, the batteries can corrode if left in damp places, or if left in for too long. Therefor, this can't be damp. Nowadays, most cameras have plastic in various places, so leaving it somewhere hot could inevitably melt it. You don't want that. If your camera is left in the cold, (18°F, 10°C) then the batteries could be severely changed. If left in a cold place, the battery life could deplete by so much as half, so in very cold climates, you will very quickly run out of power.

In order for it to sustain 3 years, you will probably need to find a climates that is about 60°F (15.5556°C) in a drier location.

I hope this helped!

8 0
4 years ago
Other questions:
  • Which of the following statements is true regarding anabolism?
    12·1 answer
  • Which instrument is used to observe the cell and in that box.A.)electronic microscope B.)telescope C.)hand lens ( )​
    12·1 answer
  • If you had a patient suffering from cholelithiasis, a possible non-surgical treatment could include:
    9·1 answer
  • Blue, brown, and green beetles from a forest migrated to a rocky mountain after a natural disaster. In the new environment, brow
    10·2 answers
  • The phylum Cycliophora was discovered in 1995. They are tiny organisms that live in large numbers on the outsides of the mouthpa
    11·1 answer
  • Which abiotic factor might be expected to change in an oak forest ecosystem if a disease destroys all of the oak trees?
    12·2 answers
  • What are found on chromosomes that allow a genetic trait to be passed on to an offspring? *
    5·1 answer
  • How does a single fertilized egg cell develop into so<br> many different types of specialized cells?
    11·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU B
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!