1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
krok68 [10]
3 years ago
15

The layer of the epidermis in which cells die because of their inability to get nutrients and oxygen is the clear layer called

Biology
1 answer:
yawa3891 [41]3 years ago
3 0
I think this layer is Stratum lucidum. This is a thin, clear layer of dead skin cells in the epidermis named for its translucent appearance when viewed using a microscope. It is also readily visible under the light microscope only in areas of thick skin, which are found on the palms of the hands and the soles of the feet.
It is located just above the stratum granulosum and below the stratum corneum.
You might be interested in
Deep, cold water is the __________. Warm, shallow water is the ___________.
Bond [772]

Answer:

densest, least densest

Explanation:

7 0
3 years ago
Which contribution from international organizations to fight disease is most necessary?
nlexa [21]
World Health Organization
8 0
3 years ago
Read 2 more answers
4. Using the image below, determine what type of solution the LYSED cell is in.solutionsolutionsolutionHOHO-Н,0LysedNormalShrive
natita [175]

The image shows a red blood cell in different solution. The first image shows an RBC in a hypotonic solutions. The RBC swell and lyse because of the osmotic movement or referred to as hemolysis. The second image shows a normal RBC in an isotonic solution. There is no net change of water to the RBC. The third image shows a shriveled RBC in a hypertonic solution. The water leak out of the RBC briskly than it enters the cell. It is also called as crenated cell.

Answer - Option C - hypotonic solution

6 0
1 year ago
Explain the role that the skeletal system plays in facilitating cardiovascular system function
Arturiano [62]

Answer:

Skeletal system provide strength and protection to heart and also produces essential blood cells such as RBC and WBC

Explanation:

All organ systems in our body work in co-ordination with each other. Skeletal system comprised of bones and cartilages while cardiovascular system comprises of hearts, blood and blood vessels. Firstly the skeletal system protects the heart and also assists in its pumping along with muscle. Secondly, the blood cells such as RBC and WBC are circulated by the blood throughout the body. However these cells are produced in the bone marrow (inside the bones)  

4 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Other questions:
  • What macromolecules are capable of self-replication?
    14·2 answers
  • An activity that occurs in the human body is shown below.
    7·1 answer
  • Which factors contribute to the weathering of rock? Check all that apply.
    5·2 answers
  • Evaporative cooling is a product of evolution that has evolved in some organisms for use under certain environmental conditions.
    7·1 answer
  • A scientist cultures the dried soup from a 4,000-year-old cooking pot found in an Egyptian tomb and obtains a distinctive specie
    15·1 answer
  • Is the baggie or beaker more concentrated in starch?
    15·1 answer
  • Which type of muscle cell is responsible for performing Peristalsis?
    8·2 answers
  • How could a change in the DNA sequence of a single gene affect an organism?
    8·1 answer
  • Question 4
    12·1 answer
  • For an individual to have the behavioral expression of the disorder pku, the individual must inherit a recessive combination of
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!