1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Wewaii [24]
3 years ago
6

The offspring of two parents obtains a single copy of every gene from each parent. T/F?

Biology
1 answer:
slega [8]3 years ago
6 0
True is the answer................
You might be interested in
This is alphabetical so which goas in order shimmer signal obscure nonsense and nominate please say it right
goblinko [34]
This is the order:
Nominate, Nonsense, Obscure, Shimmer, Signal
6 0
4 years ago
Can you help me with this question?
lozanna [386]
Idk how would I know ask your mom or dad or whatever family or friends you have... if you don’t that’s sad
7 0
3 years ago
If you were to find a clean well-sorted sandstone what geologic events may have caused this? How are these events different from
OverLord2011 [107]

Answer: Arenite

Explanation:

Arenite can be defined as the sedimentary clastic rock.

It is of the sand grain size.

It also comprises of matrix.

It is a metamorphosed sediment.

Arenite is formed by the erosion of the turbiditic re-deposition of the sands. It belongs to silicatic limestones.

5 0
3 years ago
Which statement is an example of immigration?
12345 [234]
A pack of wolves move into a forest
7 0
3 years ago
Read 2 more answers
How does an area's weather differ from the area's climate?
DerKrebs [107]

C

Weather is the day-to-day changes in the atmospheric conditions of  regions. Weather parameters are usually temperatures, humidity, rainfall, air pressure, and etcetera. These vary greatly every so often on a daily basis. Climate, on the other hand is categories into arctic, subarctic, subterranean, Mediterranean, temperature, equatorial, and etcetera.

Explanation:

When weather is studied for a long time, such as for over 30 years, general weather patterns can be discerned that will determine the climate of the region. These general weather patterns over a region will make up its climate. Climate does not change considerably. Therefore the climate of a region remains steady. If the climate of a region changes it does so ever so slightly over millennia  and would change because of phenomena like earth’s tectonic plate movements, space phenomenons, and human activities.

Lean More:

To get more on climate and weather;

brainly.com/question/8407720

brainly.com/question/10856870

#LearnWithBrainly

6 0
3 years ago
Other questions:
  • Which organ systems are used to help the body shiver?
    14·2 answers
  • Quick and simple science question. Please answer.
    8·1 answer
  • What would happen to the ecosystem if there were no competitors
    13·1 answer
  • In a paramecium, the nucleus divides first and then the cytoplasm divides, forming two identical daughter cells. Which type of r
    13·2 answers
  • How does a circular template stop replication a. A polymerase falls off at the correct time, different polymerases last differen
    13·1 answer
  • In sunflowers, tall stems are dominant (S) over short stems. If the stem
    12·1 answer
  • To control the population of insects, if insecticides are used then how it will affect the population of birds?
    7·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Please help I am confused
    11·1 answer
  • Mitosis cell division are required to form 64 cell for one cell?<br>a.4<br>b.6<br>c.16<br>d.32<br>​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!