1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAVERICK [17]
3 years ago
11

The tRNA for GUCAUCGAUCGAUCGGAUGCC

Biology
1 answer:
Lapatulllka [165]3 years ago
3 0

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

You might be interested in
Im stuck! Please help
Mademuasel [1]

When it is winter in the Northern Hemisphere, the Southern Hemisphere faces the Sun more directly and thus experiences warmer temperatures than the Northern Hemisphere. Meaning that the date is June 21- summer

6 0
3 years ago
What do checkpoints do in the cell cycle?
denpristay [2]

Answer: Checkpoints in the cell cycle A checkpoint is a moment in the eukaryotic cell cycle where the cell considers internal and external inputs before deciding whether or not to divide. There are other checkpoints, but the following are the three most important: At the G/S changeover, there is a G checkpoint.

Explanation:

knowledge!

5 0
3 years ago
_____ play a vital role in recycling nutrients and creating a balance of Earths materials
mart [117]
C. :)

hope i helped - beanz
5 0
4 years ago
Read 2 more answers
This group of enzymes digests the majority of ingested fat.
Kitty [74]

Answer:

Option A

Explanation:

Undigested fats include all those fatty acid and lipids which do not have the ability to dissolve in water. This inability makes them difficult elements for digestion. All this undigested fat accumulates and reaches the intestine for digestion as globs. Globs are emulsified by the bile salts and are broken down into smaller fat droplets. The smaller fat droplets have large surface area and hence now they can be acted upon by the fat-digesting enzyme pancreatic lipase. Thus, the first set of enzymes that act upon the undigested fats in the intestine are pancreatic lipase

Hence, option A is correct

5 0
4 years ago
Which accurately describes gymnosperms? Check all that apply. Some of them lose their leaves in winter.Some of them lack seeds.S
AleksandrR [38]
I think that correct answers are:
<span>Some of them lose their leaves in winter. (i.e. <span><em>Larix</em></span>)</span>
<span>They include the tallest plants (i.e<em>.Sequoia)

</em>I don't think they are the oldest type of seed plants, since in the past the classes like progymnosperms and seed ferns existed prior to the gymnosperms. But question isn't absolutely clear to me and I can't be 100% sure.
All of the gymnosperms have seeds unless human grows some seedless variant.
Gymnosperms don't have flowers like angiosperms do, but some people think that cone is kind of flower.
Male cones produce pollen, not female.
Hope I helped :)
<em /></span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • Identify 2 things that can cause mutations
    7·1 answer
  • Dna sequence 5' - a c t g c t a c - 3', which best represents the complementary rna?
    14·1 answer
  • 1. The density of a typical nucleus is equivalent to which scenario:
    13·2 answers
  • What are the functions of aerial roots?
    9·1 answer
  • How is it possible for an offspring to exhibit a recessive trait if neither parent exhibited that recessive trait? What must be
    7·1 answer
  • Why was Charles Darwin's carriage stoned
    10·1 answer
  • Comparing amino acid sequences in proteins has been used to determine the relatedness of organisms. Below is a graphic that show
    14·1 answer
  • Explain what polarity is in relation to water and oil
    6·1 answer
  • 2. Name three plants that reproduce by vegetative propagation.
    15·1 answer
  • For some biosynthetic reactions, such as the synthesis of nucleic acids, the energy supplied by the hydrolysis of ATP to ADP and
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!