1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAVERICK [17]
3 years ago
11

The tRNA for GUCAUCGAUCGAUCGGAUGCC

Biology
1 answer:
Lapatulllka [165]3 years ago
3 0

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

You might be interested in
In a particular environment, populations that are very different from each other are less likely to _____ with each other for re
Rina8888 [55]
They won't compete with each other because they may have different niches. For example, cows and dogs won't compete with their food since cows only eat grass, whereas dogs eat meat and vegetables but not raw grass.

I hope I was able to explain clearly. Have a good day.
5 0
3 years ago
Porque voy a estudiar nutrición y dietética?
Ostrovityanka [42]

Answer:

La carrera de nutrición y dietética forma profesionales altamente capacitados en el campo de la salud desde una perspectiva de la alimentación

Explanation:

La alimentación es un aspecto clave en la vida que se encuentra relacionado directamente con la cantidad y calidad de los alimentos que ingerimos, lo cual es fundamental para tener una vida saludable y desarrollar un estado de bienestar tanto físico como emocional. La carrera de nutrición y dietética pertenece al área de la salud y tiene como objetivo formar profesionales que se encuentren altamente especializados para el desarrollo de programas de alimentación adecuados, teniendo en cuenta las características intrínsecas de los grupos de alimentos, sus propiedades y los requerimientos personalizados para cada paciente. En consecuencia, los profesionales en nutrición y dietética desarrollan un conocimiento profundo acerca de cuales son los requerimientos en macronutrientes (proteínas, hidratos de carbono y lípidos) y micronutrientes (vitaminas y minerales) para cada individuo, esto con la finalidad de adaptar la alimentación de acuerdo a su edad, peso corporal, estatura, etc. Los profesionales en este campo poseen además conocimientos avanzados en biología humana, bioquímica, química orgánica, como así también desarrollan aptitudes en psicología y salubridad alimentaria.

6 0
2 years ago
Each heredity trait corresponds to ___ ?
Ymorist [56]

Answer:

a sequence of nitrogen bases

Explanation:

5 0
3 years ago
When glucose is high, camp is _____ : cap _____ bind the lac operator, and rna polymerase _____ bind the lac promoter. high; doe
mote1985 [20]
When glucose is high, cAMP is low; CAP does not bind the lac operator, and RNA polymerase does not bind the lac promoter. CAP is only active when glucose levels are low, which means the cAMP levels are high, and therefore the lac operon can only be transcribed at high rate when glucose is absent.  The importance of this is that the bacteria only turns on the lac operon and start using lactose only after they have used up all the preferred energy source which is glucose. 
6 0
3 years ago
Read 2 more answers
Function of hair erecter muscles? your points has to be of 10 marks to get a brainiest
Natasha_Volkova [10]

Answer:  a tiny muscle connected to each hair follicle and the skin. When it contracts it causes the hair to stand erect, and a "goosebump" forms on the skin.

8 0
3 years ago
Other questions:
  • Which characteristicof life do all of these examples describe
    5·1 answer
  • What are the 6 steps of the scientific process
    6·2 answers
  • Which three symptoms would earn a diagnosis of metabolic syndrome ?
    10·1 answer
  • Which of the following should be given to students before they begin a laboratory experiment?
    5·2 answers
  • How is carbon exchanged between biosphere and geosphere to maintain life
    12·1 answer
  • Chromosomes that code for the same traits (but often different versions of those traits) are called type your answer...
    12·1 answer
  • A boxer has been jumping rope for an hour. His leg muscles are burning and he feels weak. Which of the following most likely exp
    11·2 answers
  • What factors should we consider when determining why the chicken "loses" to the fox? A chicken can fly and perch on higher place
    7·1 answer
  • What can be used as both a moderator and a coolant in nuclear power plants?
    9·1 answer
  • Which characteristic describes the troposphere <br> PLSSS SEND HELP <br> (science btw)
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!