1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAVERICK [17]
4 years ago
11

The tRNA for GUCAUCGAUCGAUCGGAUGCC

Biology
1 answer:
Lapatulllka [165]4 years ago
3 0

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

You might be interested in
Where do you cut on a DNA strand to get the insulin out
faltersainse [42]
1.Treat 25 mg of tissue with Proteinase K by adding 20 ml of stock PK solution (20 mg/ml) and 180 ul water. Function: proteinase destroys protein. 
2.Let sit at 55 degrees for at least 1 hour. Function: This temperature is optimal for enzyme reaction; if too high will degrade DNAase. 
3.Add 1/10 volume of Kac (potassium acetate) (5 M; pH 5.6) (in this example, 20 ul but remember the 1/10 proportion as a general rule). . Mix well and place on ice for 10 minutes. Function: precipitates membrane, C, H, O, lipids, proteins, and monomers. 
4.Add 200 ml of phenol saturated with 10mM Tris. ( IN HOOD) Function: removes nonpolar proteins, lipid residue. 
5.Cap tube: mix well by inverting tube. 
6.Spin 5 minutes in microfuge. 
Function: separates aqueous (top) and phenol (bottom) layers 7.Remove upper aqueous layer (CONTAINS DNA) to a new tube. 
8.Add 200 ul of chloroform to aqueous layer (IN HOOD). Function: removes excess phenol from DNA. 
9.Cap tub; mix well by inverting. Function: sets an emulsion; biphasic solution. 
10.Remove upper aqueous layer (CONTAINS DNA) to a new tube. 
11.Add 500 ul of EtOH and cap tube (again, 500 in this example; as a proportion use twice the total amount). Function: precipitates DNA; DNA is insoluble in ethanol. 
12.Cap tube; mix well by inverting tube several times. 
13.Spin for 5 minutes in microfuge. 13000 rpm. (10 min. at 6000.) Function: collects DNA in bottom of the tube. 

6 0
3 years ago
Sedimentary rock form by
iVinArrow [24]
Your answer is B. pressure and cementation.

If you look at a sedimentary rock, you see that there is layers.

Hope this helps and have a nice day!!!

- Moon
4 0
3 years ago
Help<br> i don’t understand this question
Setler79 [48]
Yeah same mansion that
5 0
3 years ago
How are artificial selection and natural selection different? Select the best answer from the choices below. a In artificial sel
Tomtit [17]
D. Artificial selection means that it doesn’t happen naturally, many dogs breeds exist because of artificial selection
6 0
3 years ago
Read 2 more answers
Which has more potential energy (or the same?), Joe Arva sitting in a tree, or the apple next to him?
Tpy6a [65]

Joe arva as he has more mass than the apple.

3 0
4 years ago
Other questions:
  • HELP CANT GET WRONG, word bank
    6·2 answers
  • Based on the picture which type of plant is malva assurgentiflora
    5·1 answer
  • Final question for reflection: what would you say to someone who says "bacteria are learning how to survive today's antibiotics?
    8·1 answer
  • What would happen if most of the forests of Earth were cut down?
    14·1 answer
  • Conducting experiments,
    10·1 answer
  • Activation of the parasympathetic nervous system results in ________
    13·1 answer
  • Which statement describes an effect of natural
    11·1 answer
  • What condition is caused by carbon dioxide, methane, and water vapor trapping heat in the Earth's
    6·1 answer
  • I think it’s tree am I right?
    14·1 answer
  • What role does evolution play in the emergence of antibiotic resistance in bacteria?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!