1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAVERICK [17]
4 years ago
11

The tRNA for GUCAUCGAUCGAUCGGAUGCC

Biology
1 answer:
Lapatulllka [165]4 years ago
3 0

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

You might be interested in
2. Is the practice of genetically modifying human cells ethical? Why or why not?
postnew [5]

its all dependent upon the person in question

4 0
3 years ago
There are two species of sparrows that appear very similar to each other. A scientist tried to mate them. He observed that in sp
FrozenT [24]
Reproductive isolation
5 0
3 years ago
Read 2 more answers
An igneous rock sample is about 250,000 years old. would you use uranium-lead radiometric dating to find its age?
Veronika [31]

And igneous rock sample is about 250,000 years old. Would you use uranium-lead radiometric dating to find its age?Answer:

Explanation:

4 0
3 years ago
What are prions? How are they linked to BSE?
Vilka [71]
Prions is a disease and are a family of rare progressive neurodegenerative disorders that affect both humans and animals.
5 0
3 years ago
Fun facts about asexual reproduction
hjlf
Well, it's awesome that the reproduction literally grows out of main source. Like in a plant. Awesome jazz, man. 
7 0
3 years ago
Read 2 more answers
Other questions:
  • Botulism is generally associated with ingestion of the toxin produced by clostridium botulinum. the activity of the toxin will r
    13·1 answer
  • Society expects to follow ethical practices and meet many ethical standards. Which is an example of one of those ethical standar
    13·1 answer
  • Flow chart of how a protein is produced and shipped from a cell
    6·1 answer
  • Macrophages express multiple types of receptors on their surface that stimulate phagocytosis of microbes, leading to pathogen in
    6·1 answer
  • What is the purpose of Mitosis In single-celled organisms
    8·1 answer
  • the DNA sequence reads ACGTTCATT before a mutation occurs. after the mutation, the DNA sequence reads ATCGTTCATT. which type of
    14·2 answers
  • Which feature typically contains water only during a rainstorm and right after it rains?
    7·1 answer
  • Igneous rock is formed from the cooling and crystallization of magma or partially melted rock. Igneous rock can be either intrus
    11·1 answer
  • How old is george washington
    5·2 answers
  • Identify the structures in the celll pictured on the right
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!