1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAVERICK [17]
3 years ago
11

The tRNA for GUCAUCGAUCGAUCGGAUGCC

Biology
1 answer:
Lapatulllka [165]3 years ago
3 0

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

You might be interested in
Name every "thing" On this planet.
hichkok12 [17]
I shall name every “thing” here on this planet Sam
4 0
3 years ago
Read 2 more answers
DNA<br>"Deoxyribonucleic<br>Acid"​
Zarrin [17]

Answer:

Details about DNA are given in the explanation section. Hope it will be helpful for you.

Explanation:

DNA, or deoxyribonucleic acid, is the hereditary element in humans and almost all other organisms. Nearly every cell in a person’s body has the same type of DNA. Most DNA is found in the cell nucleus (nuclear DNA), but a small quantity of DNA can also be found in the mitochondria (mitochondrial DNA or mtDNA).

The information in DNA is stored as a code made up of four chemical bases: adenine (A), guanine (G), cytosine (C), and thymine (T). Human DNA consists of about 3 billion bases, and more than 99 percent of those bases are the same type in all people.

DNA bases pair up with each other, A with T and C with G, to form units that are called base pairs. Each base is also attached to a sugar molecule and a phosphate molecule.  A base, sugar, and phosphate are called a nucleotide. Nucleotides are arranged in two long strands that form a spiral called a double helix.

A valuable feature of DNA is that it can replicate, or make copies of itself. Each strand of DNA in the double helix can serve as a pattern for duplicating the sequence of bases.

7 0
4 years ago
Which organism is not a consumer?
OverLord2011 [107]
Answer: c. grass (producer)
4 0
4 years ago
Read 2 more answers
The star in the diagram
Arada [10]

Answer:

B.) Replication fork

Explanation:

The replication fork is the point at which two strands of DNA separate via DNA helicase.

The origin of replication is the site on a singular DNA strand where replication begins. Here, complementary nucleotides begin bonding to the single-stranded DNA via DNA polymerase.

The replication bubble is created when DNA helicase separates a DNA strand. The DNA helicase does not separate the entire strand, but rather opens only certain sections at one time. This creates a "bubble" in the DNA strand where replication will take place.

Okazaki fragments are formed on the lagging strand of the single-stranded DNA. Because DNA is only created from the 5' to 3' direction, RNA primase must reposition itself after adding a primer (made of nucleotides). DNA polymerase then fills in these fragments with more complementary nucleotides in small sections.

3 0
2 years ago
How does the immune system protect the body from disease?.
Margarita [4]
The immune system protects the body from possibly harmful substances by recognizing and responding to antigens.
3 0
2 years ago
Read 2 more answers
Other questions:
  • make a decision about the molecule nahco3 classification as organic or inorganic. In two or more complete sentenced state and de
    10·2 answers
  • You have a bag of hot Cheetos lunch. List at least three organ systems you will need t use to eat the Cheetos, break them down f
    15·1 answer
  • Four students are asked to list characteristics of RNA in a table as part of an assignment. Which student listed the characteris
    10·2 answers
  • Why is the entire cell said to be like factory
    7·1 answer
  • Where haploid cells are found in adults
    12·1 answer
  • Describe the overall goal of photosynthesis and include the complete chemical reactions (in chemical form)
    10·1 answer
  • To which of the following environmental changes are pupulations most able to adapt?
    13·2 answers
  • Somebody help me so I can give y’all some points
    12·1 answer
  • I need help pls somebody​
    6·1 answer
  • comparison of transfection agents in forming complexes with ferumoxides, cell labeling efficiency, and cellular viability
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!