Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
<h2>
Answer:
</h2><h3>The correct answer is option C.
</h3>
<h2>
Explanation:
</h2>
From the following question, the third option is right, because when the shining light create a horizontal beam over the spacecraft, the observer who is on the earth would see that light in the same way at the time spacecraft is at rest and when observer in the spacecraft at the time spacecraft is at rest.
So this is the correct answer.
Respuesta:Newton (unidad) en física, newton (N) es la unidad de fuerza en el sistema internacional de unidades, nombrada así en reconocimiento a issac Newton por su trabajo en la medicina clásica.... es una unidad derivada del sí,que se compone de unidades básicas kg x m x s-2
(A)Until the onset of PUBERTY,
