1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAVERICK [17]
3 years ago
11

The tRNA for GUCAUCGAUCGAUCGGAUGCC

Biology
1 answer:
Lapatulllka [165]3 years ago
3 0

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

You might be interested in
How are plants adapted to the climate found in the UAE
Shkiper50 [21]

Explanation:

<em>Plants adapt to environmental stress by altering their metabolism, flowering, growth, and reproduction; and by migrating toward areas with more favorable climatic conditions.</em>

<em>Sorry if wrong ....</em>

3 0
4 years ago
What Is Ebola? How did it start? How do you spread it?
Grace [21]
Ebola is a deadly virus that tricks the body into damaging its own blood vessels. It originated near the ebola river when some animals probably bit someone or someone went into the river and got the virus inside of them through the nose, mouth, ears, open wounds, or other areas. The only way you can spread it is by getting one's body fluids that is infected with ebola (such as spit, mucus, or other fluids that come from the body), on somebody and the fluid somehow works its way into the body.
3 0
3 years ago
A muscle fiber will respond to a stimulus when that stimulus reaches the _____ level.
Hatshy [7]
A muscle fiber will respond to a stimulus when that stimulus reaches the threshold level. These local classified potentials which are mainly related with external stimuli extent the axon preliminary segment and construct up to they manage to extent the threshold value. The bigger the stimulus the larger the depolarization or try to reach threshold.
4 0
3 years ago
"The ____ is the division of the autonomic nervous system that coordinates arousal and involves the expenditure of energy."
finlep [7]

Answer:

Sympathetic nervous system

Explanation:

The sympathetic nervous system is the part of the autonomic system of neurons which gets activated in the condition of stress.

The stress conditions activate the sympathetic nervous system which prepares the human body for the stress condition by either fight or flight mode.

The fight or flight responses requires a large amount of energy which are produced by the activation of the parasympathetic energy therefore the sympathetic system involves the expenditure of the energy. The system is also involved in sexual arousal.

Thus, the Sympathetic nervous system is the correct answer.

3 0
3 years ago
In ancient times, people classified plants and animals by use.true or false?
LUCKY_DIMON [66]
True ..............................
6 0
3 years ago
Other questions:
  • List by size: gene, cell, chromosome, atom, nucleus, base subunit, nucleotide
    14·1 answer
  • You notice your friends MP3 player is turned up so loud you can make out the words to each song though she is wearing earbuds. Y
    8·1 answer
  • Which of the following best explains why what we know about cells is called a theory and not a law?
    9·2 answers
  • Which of these are the correct sequence of events at a crime scene?
    15·2 answers
  • Dr. Smith reads two research papers that present different conclusions about the same questlon. He knows the researcher who wrot
    12·1 answer
  • The northern elephant seal was hunted almost to extinction during the 18th and 19th centuries. Less than 100 seals were left to
    13·1 answer
  • What is the name of the process by which plants take in sunlight, carbon dioxide, and water, allowing them to make sugar and oxy
    14·2 answers
  • Please help this will help me pass high school I just need this one answer please will like it
    15·1 answer
  • Which of the following is an example of a renewable resource? a. coal b. oil c. gas d. water please select the best answer from
    9·1 answer
  • Earth is not filled to the brim with elephants, or ants, or ferns, or geckos. What prevents a population from growing forever? m
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!