1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAVERICK [17]
3 years ago
11

The tRNA for GUCAUCGAUCGAUCGGAUGCC

Biology
1 answer:
Lapatulllka [165]3 years ago
3 0

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

You might be interested in
Which characteristic differentiates amphibians from reptiles?
Stells [14]

Option D – amphibians may use their skin for gas exchange is the characteristic feature of amphibians that differs from reptiles.

Explanation:

The amphibian skin is moist, thin and marbled and supplied by blood vessels running on its surface. The moisture present in the skin dissolves the oxygen present in its surrounding which is absorbed by the blood vessels. Special glands help the amphibians to keep the skin moist.

The very thick and tough scales present on the reptiles prevent them to absorb oxygen through their skin. Hence, they breathe and respire through their lungs.

Amphibians have three-chambered heart. They do not develop amniotic eggs. Adult amphibians although spend much time on land, they breed only in water due to the absence of amniotic sac .

7 0
3 years ago
Explain how the water vascular system allows an echinoderm to move along the ocean floor. Please help!
astra-53 [7]

Answer: Sea stars move using a water vascular system. Water comes into the system via the madreporite. It is then circulated from the stone canal to the ring canal and into the radial canals.

Explanation: The radial canals carry water to the ampullae and provide suction to the tube feet.

3 0
3 years ago
Read 2 more answers
Please select the word from the list that best fits the definition what chemical weathering called oxidation causes
Tju [1.3M]
A. rust because rust is the only chemical weathering listed in the answers that i know of 
Hope this helps!!!!!!!!
5 0
3 years ago
Read 2 more answers
Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5’-ATCGTACCGTTA-3’. (b) What
vlabodo [156]

Answer:

The mRNA molecule will be synthesized running in the 5' to 3' direction.

Explanation:

From the DNA sequence:

5'-ATCGTACCGTTA-3'

3'-TAGCATGGCAAT-5'

mRNA sequence is

5'-AUCGUACCGUUA-3'

Amino acid sequence will thus be:

Ileu-val-pro-leu.

8 0
3 years ago
Read 2 more answers
Why would minerals take millions of years to form? Explain please. If you do, you will be the brainliest with an extra 18 points
luda_lava [24]
Because types of chemicals in minerals need to form.
8 0
3 years ago
Other questions:
  • What are Cinder Cone Volcanoes made of?
    8·1 answer
  • Cholesterol creates stability in the fluid mosaic model. Can you think of another structure that does the same thing in a plant
    12·2 answers
  • I need help ASAP
    5·1 answer
  • Use what you know about fossils to choose the correct answers from the drop-down menus to complete each
    14·2 answers
  • In an experiment to test a new drug’s effectiveness, one group is given a larger dosage than is typically prescribed, and a seco
    14·2 answers
  • Which of the following best describes the function for the organelle labelled ‘D’?
    7·1 answer
  • what most likely affected cell differentiation in the growing embryo if the baby was born with asthma like symptoms
    11·1 answer
  • Check all that apply as characteristics of myelinated axons. Check All That Apply Myelinated axons transmit nerve impulses via c
    12·1 answer
  • PLEASE HELP! (c) Complete the table to represent the relationship between volume and surface area of a spherical structure surro
    6·1 answer
  • What is the output of (A + B)(A + C)?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!