1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAVERICK [17]
3 years ago
11

The tRNA for GUCAUCGAUCGAUCGGAUGCC

Biology
1 answer:
Lapatulllka [165]3 years ago
3 0

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

You might be interested in
Who created the Wave?
emmainna [20.7K]
Assuming you mean that type of wave that crowds do at games, where a group of people throw their hands up and whoever is next to them throws their hands up shortly after and it continues down the crowd

<span>"Krazy" George Henderson created it

:)
</span>
4 0
3 years ago
What system controls the body by means of chemical molecules called hormones?
AysviL [449]
It would be the endocrine system. 
7 0
3 years ago
HELP ASAP DUE TONIGHT!!!!
stiv31 [10]

Answer:Over time, carbon-14 decays in predictable ways. And with the help of radiocarbon dating, researchers can use that decay as a kind of clock that allows them to peer into the past and determine absolute dates for everything from wood to food, pollen, poop, and even dead animals and humans.

Explanation:

8 0
3 years ago
Which of the following statements is true?
QveST [7]

Answer:

3- As cells get larger, the volume increases more than the surface area

Explanation:

As a cell develops, it grows larger and extends the cell membrane. Sadly, the volume rises greater than that of the surface area, and therefore the relative surface area usable to transfer resources to a unit cell volume declines gradually.

3 0
3 years ago
Read 2 more answers
What is the atomic nucleus made of?
Korvikt [17]
Protons and neutrons. But since the protons outweigh the neutrons. so your answer is d
8 0
3 years ago
Read 2 more answers
Other questions:
  • Scientists find the same type of index fossil in two different locations on Earth. What can they conclude from this discovery? T
    15·2 answers
  • 6. Classify Earth's layers based on their physical properties. *
    5·1 answer
  • Which elements are part of an area's topography? Check all that apply.
    10·1 answer
  • Amino acids are linked together to make proteins by removing a molecule of _____ in a process called _______
    10·2 answers
  • Which of the following is NOT TRUE of animals that have open circulatory systems?
    13·1 answer
  • Why might a point mutation in DNA make a diffrence inb the level of proteins activity?
    10·1 answer
  • Hemophilia is a serious bleeding disorder cause by a sex-linked recessive allele. What are the chances of a normal male and a fe
    14·1 answer
  • Arrange the structures to show how they are organized in the human body. Place the smallest unit on top, and units of increasing
    6·1 answer
  • Which of these is a behavioral response determined passed experience
    12·2 answers
  • Inattention is generally caused by concentration on __________.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!