1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAVERICK [17]
3 years ago
11

The tRNA for GUCAUCGAUCGAUCGGAUGCC

Biology
1 answer:
Lapatulllka [165]3 years ago
3 0

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

You might be interested in
What fill the region between the cell membrane and the nucleus?
Ahat [919]
<span>The fluid-filled region between the nucleus and the cell membrane is called the CYTOPLASM. ... This is because cytoplasm is packed with organelles that are critical to a cell's survival, including mitochondria, ribosomes, Golgi bodies, and the endoplasmic reticulum.</span>
4 0
3 years ago
How do genes determine how we look and act?
sergeinik [125]

Answer:

These pairs of genes then determine certain physical features or traits. The genes that you have in your body right now make up your genotype. This genotype then determines your physical appearance, which is called your phenotype. In this activity, you will be given two sets of chromosomes.

Explanation:

3 0
2 years ago
Is any trace of an ancient organism preserved in rock. Wegener s theory that the​
lesya [120]

Answer:

yes

Explanation:

i had it

3 0
3 years ago
What usually happens to ice before it changes into gas?
a_sh-v [17]
<span>Sublimation is the conversion between the solid and the gaseous phases of matter, with no intermediate liquid stage.</span>
6 0
2 years ago
Unsaturated and saturated lipids exhibit different characteristic based on their structures wich characteristic is unique to sat
xz_007 [3.2K]

Answer:

I believe the answer is C.

Explanation:

Hope my answer has helped you!

6 0
2 years ago
Other questions:
  • For the average young adult female resting in a reclined position, the heart pumps out approximately 5 liters of blood per minut
    6·1 answer
  • Around _____ of women have severe vaginal or pelvic pain during sexual intercourse for up to one year after giving birth.
    5·2 answers
  • Define <br>1) Gregarious in one line. <br>2)Epiphytes in one line.
    8·2 answers
  • Plant cells contain plastids. Name two examples and explain their function within the plant cell.
    6·1 answer
  • Which options correctly identify a feature of a scientific report that would suggest the report reflects scientific thinking?
    7·1 answer
  • Following glycolysis and the citric acid cycle, but before the electron transport chain and oxidative phosphorylation, the carbo
    8·1 answer
  • What would happen to the light independent reactions if you put a plant in a dark closet for many days?
    9·1 answer
  • Please help me out once again
    13·2 answers
  • The double-helix structure of DNA:
    6·1 answer
  • The passage of IgG antibodies from mother to fetus illustrates: A. natural immunity. B. cell-mediated immunity. C. passive immun
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!