1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nasty-shy [4]
3 years ago
6

Your carbone footprint is most closely the result of your ?

Biology
1 answer:
Lemur [1.5K]3 years ago
4 0
Life style. if your life style is bad then your carbon will be bigger. the better your life style is the smaller your carbon footprint will be.
You might be interested in
Label each level of dna packaging in the eukaryotic chromosome with the appropriate term.
Lostsunrise [7]
I assume this photo has the labels you are talking about.

DNA double helix consists of two strands that wind around each other with their nucleotides liked.-> it's the structure number 5
 nucleosome- it's a segment of DNA wound in sequence around eight histones (proteins)- number 2
Histone- proteins with DNA around them, forming the nucleosome- number 4
Tight helical fiber- chromatin <span>coiled very tightly- 3
Cromosome- </span><span>chromatin condensed even tighter forming a X shape.- 1</span>








3 0
3 years ago
Read 2 more answers
3. Species that are in danger of becoming extinct in the near future is known a. endangered species c. Exotic Species Species c.
lianna [129]
They are known as Endangered
5 0
2 years ago
Read 2 more answers
Explain how a particular type of stress can cause the extinction of a species.
Whitepunk [10]
The answer is environmental stress
3 0
3 years ago
A horizontal line on the velocity vs. time graph indicates a constant, positive acceleration.
3241004551 [841]

The following statement is false, and it's 5 points not 50 :-)

5 0
3 years ago
Read 2 more answers
Consider Darwin's first writings on the theory of natural selection. An important point of Darwin's Essay on the Principle of Po
Eduardwww [97]

Answer:idk

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • What is diffusion,active transport and osmosis
    15·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Most of the energy released by oxidizing glucose is saved in the high-energy bonds of what molecules?
    5·1 answer
  • explain how the rate of photosynthesis or cellular respiration can be measured using products or reactants
    7·1 answer
  • Lazzaro Spallanzani and Louis Pateur both performed experiments hoping to disprove the hypothesis that organisms can form by spo
    14·2 answers
  • What is called the next step in scientific method following making a prediction
    14·2 answers
  • 9. How is an organism made?
    10·2 answers
  • Which two processes are responsible for the formation of fog?
    14·1 answer
  • How does pinocytosis work?
    10·1 answer
  • What's the detergent that kills mucus​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!