1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dybincka [34]
3 years ago
8

What period of the Mesozoic era did birds first appear?

Biology
2 answers:
lakkis [162]3 years ago
6 0
<span>The dinosaurs and the mammals appeared during the Triassic period, roughly 225 million years ago. The dinosaurs went extinct 65 million years ago. The Mesozoic Era lasted about 180 million years, and is divided into three periods, the Triassic, the Jurassic, and the Cretaceous.</span>
Komok [63]3 years ago
4 0

The earliest known birds appeared during the Jurassic Period of the Mesozoic Era, approximately 150 million years ago.


Thats what google said, sooo you decide what you want to do. :) Good luck!

You might be interested in
Explain the method scientists use to study how Eath's atmosphere and climate have changed during the past million
bonufazy [111]

Answer:

The study that involves the research over earth atmosphere and climate changes in the past is known as the paleoclimatology. The study mainly concentrate over the past climates of Earth and atmospheric changes that took place in the past centuries. Studying fossils.

Explanation:

5 0
3 years ago
Evidence of climate changes and conditions that affected early societies are gathered from _____. written records ice core sampl
pogonyaev
I go with Ice Core examples since early sociteties probably didn't have Written Records or maps, and tree rings would only tell if they were fossilized. I hope this helped :)
8 0
3 years ago
Which of the following are most responsible for the success of the cane toad as an invasive species in Australia?
Vinil7 [7]
The correct answer is letter A. Venom glands and varied diets are the reasons why cane toads are considered as invasive species in Australia. They cause major ecological imbalance within their immediate surroundings and have caused an infestation all over Australia.
4 0
3 years ago
Read 2 more answers
What part of the brain is responsible for the production of male hormones?
Lana71 [14]
The pituitary gland and the hypothalamus, located at the base of your brain, control the production of your male hormones and sperm.
6 0
3 years ago
A tertiary consumer, such as a red-tailed hawk, receives what percent of the energy fixed by primary producers in a typical fiel
myrzilka [38]
Assuming a 10% trophic efficiency, the herbivore (primary consumer) will get 10% of the producer energy. Then, the second consumer that eat the herbivore will get 10% of the primary consumer energy, so it is 10%*10%= 1% of the primary producers.
Then, the t<span>ertiary consumer should get 0.1% of the primary producers' energy.</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A student was given a task to observe a bacterial specimen made from dilute yoghurt and sketch the shape of bacteria seen. He dr
    6·1 answer
  • (20 POINTS) What is the difference between haploid and diploid cells, and where are they important exactly?
    9·1 answer
  • A human skin cell contains 46 chromosomes.A frog sperm cell contains 12 chromosomes.which pair of number shows the chromosomes n
    12·1 answer
  • The enzyme dna _______ chemically bonds together two dna strands and removes nicks in a dna duplex.
    9·1 answer
  • Which of the following would make the BEST conductor? a.) water
    14·2 answers
  • In some cases of head injuries, the cerebrum may be affected. This type of injury could cause a loss of and impaired
    11·2 answers
  • Choose one property of water that makes it unique. Describe the property and explain the chemical or or physical reason that cau
    7·1 answer
  • Select the correct answer.
    15·1 answer
  • In cattle partially chewed cud store in what chamber of stomatch​
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!