1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
topjm [15]
2 years ago
11

How can we measure motives?

Biology
1 answer:
Lesechka [4]2 years ago
8 0
Motives or motions ?
You might be interested in
Plants convert light energy into chemical energy (glucose). Plants also
DerKrebs [107]

True, plants undergo cellular respiration because they need ATP.

Plants are known as primary producers in the ecosystem because they are able to directly harness the energy from the sun and convert it into complex energy molecules. This process requires ATP.

On the other hand, plants also undergo cellular respiration which is the process by which ATP is produced because the plant also needs ATP to perform the functions of cells.

Learn more: brainly.com/question/9743981

6 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
List one organism and describe all of its adaptations.​
sleet_krkn [62]

Answer:

cactus

Explanation:

heat, water loss,

7 0
2 years ago
Plants use carbohydrates to build things such as cellulose. How do plants acquire these building blocks to build mass?
AlekseyPX

Answer:

Photosynthetic process

Explanation:

Cellulose, a tough, fibrous and water-insoluble polysaccharide in the cell walls of plants. It is the most abundant organic macromolecule on Earth and also the main component of a plants structure, conferring rigidity on the plants' cells.

Cellulose chains are arranged in microfibrils or bundles of polysaccharides arranged in fibrils which in turn make up the plant cell wall.

All plants are made up of polysaccharides, a very large sugar molecule made of hundreds or thousands of single sugar units (monosaccharide). Cellulose is composed of a long chain of at least 500 glucose molecules joined together by B-1,4- linkages.

Green plants create this simple sugar molecules (glucose) on their own through the process of photosynthesis. Photosynthesis is the chemical combination or fixation of C02 and water by the utilization of energy from the absorption of visible light. This glucose produced is a building carbohydrate that combines with other sugars to form the plant structure (as they make up part of cellulose) and store energy.

4 0
3 years ago
Read 2 more answers
In females, the urinary bladder lies anterior to the vagina and uterus. in females, the urinary bladder lies anterior to the vag
rosijanka [135]
The answer is true I think
4 0
3 years ago
Other questions:
  • What is true of a rock layer that has had another rock layer deposited on top of it?
    11·3 answers
  • Over time, there will be heritable changes in which of the following?
    8·1 answer
  • What is the function of naturally occurring restriction enzymes in bacterial cells?
    13·1 answer
  • Can y’all tell me which ones I got wrong please. Thank you!!
    7·1 answer
  • Photosynthetic (autotrophic) protistans include all of the following except?
    7·1 answer
  • What level of organization is the human heart?
    9·1 answer
  • Which of the following is usually the least disruptive (least serious) type of mutation if it occurs within a gene?
    5·2 answers
  • Which type of bacteria causes tetanus?
    8·1 answer
  • ¿Qué sucedería si por una epidemia desaparecieran las golondrinas marinas?
    12·1 answer
  • Is there a relationship between earth's different climates?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!